Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|317134055\|ref\|YP_004089966.1\|	5.00E-22	ubiquitin [Ruminococcus albus 7]
KOG	KOG0003	6.00E-45	Ubiquitin/60s ribosomal protein L40 fusion
nr	gi\|590632338\|ref\|XP_007027812.1\|	1.32E-44	Ubiquitin extension protein 1 isoform 2 [Theobroma cacao]
Swissprot	tr\|P49636\|RL40_NICSY	3.00E-46	60S ribosomal protein L40 (Precursor)
trEMBL	tr\|A0A061F1C2\|A0A061F1C2_THECC	5.00E-45	Ubiquitin extension protein 1 isoform 2 {ECO:0000313\|EMBL:EOY08314.1}
TAIR	AT3G52590	6.00E-45	ubiquitin extension protein 1

Scaffold	Start	End	Strand
GWHAAEX00000338	163338	165500	+

Transcript Sequence
>GWHTAAEX010368 ATGCAGATTTTTGTGAAAACTCTCGCCAGGAAGACCATAGCCCTCGAGGTCGAGAGCATTGACACTATTGACAATGTGAGGCAAATATCTGGGATAAGGAGGGTATCGTGGATTCCTCCGGATCAACAGCGGCTGATCTTTGCCAGGATGCAGCTTGAAGATGGGCGCACATTTCCTGATTATAGCATCCAGAAAGAATCTACTATGCATCTGGTGCTGAGACTTAGGGGTGGTATCATCGAGCCCCCTCAAATGGCTCTTGCCAGGAAGTACAATCAGGATAAGATGATCTGCCACAAAATCGGAATTGGATTGGACAATATCACAAGTGTCTCCACTCTTAGGAAAAGAATAAGTTATGGAAGTTCTTACATGTATTGGGAATATAAGCTAATCTGTAAGGTTTTTGAGGATTCTTATGCGCTCTATAAACTATTCATGAAGAGTGGTTCGGGTCCAAAAAATGGAGAGCGGTATGGCACACCTTTCAGAGAAGAGGTTTGGGAAGATAATGCTGCATATAGCAAACAATAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00240.22	ubiquitin	3	76	1.10E-16
PF01020.16	Ribosomal_L40e	80	100	1.80E-05

Protein Sequence

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K02927	RP-L40e, RPL40	Ribosome	map03010

GO term	Ontology	Name
GO:0006412	Biological Process	translation
GO:0003735	Molecular Function	structural constituent of ribosome
GO:0005515	Molecular Function	protein binding
GO:0005840	Cellular Component	ribosome

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	4.940
SRP064423	SRR2545915	Juvenile tuber	5.350
SRP108465	SRR5643513	five period of Gastrodia elata	2.920
	SRR5643514	five period of Gastrodia elata	3.580
	SRR5643515	five period of Gastrodia elata	4.180
	SRR5643524	five period of Gastrodia elata	5.110
	SRR5643525	five period of Gastrodia elata	1.460
	SRR5643528	five period of Gastrodia elata	1.830
	SRR5643658	five period of Gastrodia elata	2.070
	SRR5643659	five period of Gastrodia elata	4.530
	SRR5643660	five period of Gastrodia elata	5.200
	SRR5643661	five period of Gastrodia elata	4.850
	SRR5643662	five period of Gastrodia elata	6.510
	SRR5643663	five period of Gastrodia elata	6.260
	SRR5643664	five period of Gastrodia elata	4.270
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	3.210
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	4.410
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	2.940
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	3.430
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.500
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	1.700
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	4.640
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	4.540
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	3.770
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	3.590
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	3.590
SRP279888	Gastro	Gastrodia elata tuber	3.44
	Juven	Juvenile tuber	5.74
	Mother_Gastro	Mother tuber of Gastrodia elata	1.03
	Mother_Juven	Mother tuber of Juvenile	3.54