Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|159900690\|ref\|YP_001546937.1\|	4.00E-20	cytochrome P450 [Herpetosiphon aurantiacus DSM 785]
KOG	KOG0156	1.00E-72	Cytochrome P450 CYP2 subfamily
nr	gi\|672175452\|ref\|XP_008807778.1\|	8.90E-105	PREDICTED: premnaspirodiene oxygenase-like [Phoenix dactylifera]
Swissprot	tr\|O81974\|C71D8_SOYBN	2.00E-94	Cytochrome P450 71D8
trEMBL	tr\|A0A072V779\|A0A072V779_MEDTR	5.00E-103	Cytochrome P450 family 71 protein {ECO:0000313\|EMBL:KEH34015.1}
TAIR	AT3G26320	1.00E-72	cytochrome P450, family 71, subfamily B, polypeptide 36

Scaffold	Start	End	Strand
GWHAAEX00000033	335251	336636	+

Transcript Sequence
>GWHTAAEX010546 ATGAAGACCCATGATATCGATTTTGCTTCACAACCAGAATCTCTTGCCACAAAAATACTTGTCTATAATAGCAAAGATATTGGATTTTCGCCATATGACAAATATTGGTCACAACTAAAAAAGATATGTACAGTTGAATTGCTTAGCAGCAAGCGCGTCGAGTCTTTCGGTTTCATAAGAGAGGAAGTAGGAGAGCATCTTGTGGAAAAAATTAACATGACAATGGGATCTCCCGTGAACCTCAGTGAAATATTTTTATCTTTAACATATACGACTATTTCAAGGGCAGCATTTGGGATGGGGTGCTCACACCAAAACAAATTTAATAAGGCCTTAAAAAAAGCATTACTGTATTTGTCAGGCTTTAATTTTGTTGATTTTTATCCATCATTCAGTTTTCTTGGTGATCTAACTAGCTTTCGAGCTCGGCTGAAGAGTGTGCATCGACAATTGGATGAGATCTTTGATGAGATATTTAGGGATCATCAGGCTAAGAACCTTAATGAAGATTGTGTTCATGAGGATATTGTTGATACTTTGTTCAAACTCAAAAATCATGGGAAGTTGGATATTTCACTTACAACTAAGAATATTAAAGCGATTATACTGGATATATTTATGGGAGGAATTGATACAACAACTTCGACAATGGAGTGGGCTATGTCAGAGCTCATTCGACATCCTGATATTATGCAAAAGGTTCAATTGGAAGTAAGAAAAGTTTTCGAAGGAAAAGAAAAGGTTGAATTGAGAGAGGTTAGCAAGCTTCCATACTTAAGTCAAATTGTTAAAGAAATCTTGAGATTGCACCCGATACTTCCTTTCTTGATTCCAAGGATATCTCGTAACTCAGTTGAAATTGGTGATTACACAATACTAGTCGGAACACGAATTATTATAAATGCATGGGCAATAATGAGGGACCCAAAATATTGGGTTGATCCAGAGAGATTTTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module6

Gene family	subfamily
Cytochrome P450 Family	CYP71B36

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0055114	Biological Process	oxidation-reduction process
GO:0005506	Molecular Function	iron ion binding
GO:0016705	Molecular Function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	Molecular Function	heme binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.540
SRP064423	SRR2545915	Juvenile tuber	0.300
SRP108465	SRR5643513	five period of Gastrodia elata	2.380
	SRR5643514	five period of Gastrodia elata	1.360
	SRR5643515	five period of Gastrodia elata	0.270
	SRR5643524	five period of Gastrodia elata	1.570
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.080
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	5.040
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	5.390
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	9.060
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	6.580
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	9.060
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	8.350
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	10.860
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	20.430
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	11.740
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	6.860
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	6.470
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	6.470
SRP279888	Gastro	Gastrodia elata tuber	0.11
	Juven	Juvenile tuber	0.57
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.13