Gene detail

Database	Orthologs	E value	Annotation
KOG	KOG4401	3.00E-41	Uncharacterized conserved protein
nr	gi\|672172819\|ref\|XP_008806516.1\|	1.28E-65	PREDICTED: protein LSM12 homolog A-like, partial [Phoenix dactylifera]
trEMBL	tr\|M0U0B0\|M0U0B0_MUSAM	2.00E-65	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr9P14520_001}
TAIR	AT1G24050	3.00E-41	RNA-processing, Lsm domain

Scaffold	Start	End	Strand
GWHAAEX00000033	2083187	2106688	-

Transcript Sequence
>GWHTAAEX010567 ATGAAAGAGGATTTGGATTTGAGAGAATGCATTATGAGGACTATTGATACTAGATTAAGGTGCACCAACCCTTTCTTCATGGAAGACATAAATATGTATTGGGGATACGCAAAAGAGGGAGCTTCGAAGCCAAACGGTCGCCGTAATGTTCGGTTTATAAAAGCGACCTATATCAAGGACCTCACTTTCTTGCGACGAGGGGATGATCCTCTCGACAGCCAAAAATGCTTCCTGGATCTTGCTGGATTGCAGGCAAGGGAGGAAGCCGCCCTTAGGAATGCGGAAATAGAAGCAGAGAGAATTGGTGTTGGAGTCACTGGCGAAGCCCAGAGCATTTTTGATGCATTATCTAAGACGCTTCCAGTTAGATGGGACAAGACAGCCATAGTAGTGATGAATGAAGTTAGAGTGAGCAGTCCATATATTCCTGAAAATGTCAGCGGAGGAACTCCAGCTGCTAATGAGCGAGTCAAAAAAGTGATTATTTTGCGTTGGATACACTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K23643	LSM12	Circadian rhythm - fly	map04711

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	34.550
SRP064423	SRR2545915	Juvenile tuber	45.080
SRP108465	SRR5643513	five period of Gastrodia elata	33.330
	SRR5643514	five period of Gastrodia elata	44.420
	SRR5643515	five period of Gastrodia elata	32.590
	SRR5643524	five period of Gastrodia elata	35.050
	SRR5643525	five period of Gastrodia elata	58.740
	SRR5643528	five period of Gastrodia elata	36.530
	SRR5643658	five period of Gastrodia elata	37.160
	SRR5643659	five period of Gastrodia elata	40.830
	SRR5643660	five period of Gastrodia elata	42.500
	SRR5643661	five period of Gastrodia elata	42.650
	SRR5643662	five period of Gastrodia elata	36.310
	SRR5643663	five period of Gastrodia elata	36.130
	SRR5643664	five period of Gastrodia elata	41.130
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	46.690
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	50.190
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	46.820
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	50.690
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	46.580
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	48.480
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	41.140
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	38.160
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	52.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	46.230
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	64.040
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	64.040
SRP279888	Gastro	Gastrodia elata tuber	79.09
	Juven	Juvenile tuber	82.83
	Mother_Gastro	Mother tuber of Gastrodia elata	46.97
	Mother_Juven	Mother tuber of Juvenile	43.44