Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|187736228\|ref\|YP_001878340.1\|	9.00E-17	UTP--glucose-1-phosphate uridylyltransferase [Akkermansia muciniphila ATCC BAA-835]
KOG	KOG2638	2.00E-65	UDP-glucose pyrophosphorylase
nr	gi\|674959444\|emb\|CDX74149.1\|	4.16E-67	BnaA03g28980D [Brassica napus]
Swissprot	tr\|Q9M9P3\|UGPA2_ARATH	5.00E-66	Probable UTP--glucose-1-phosphate uridylyltransferase 2
trEMBL	tr\|A0A078CD94\|A0A078CD94_BRANA	2.00E-67	BnaC03g08320D protein {ECO:0000313\|EMBL:CDX70748.1}
TAIR	AT3G03250	2.00E-65	UDP-GLUCOSE PYROPHOSPHORYLASE 1

Scaffold	Start	End	Strand
GWHAAEX00000303	226763	227625	+

Transcript Sequence
>GWHTAAEX010721 CTACTTTTGGAATTTGCACAAGTTCCTGATGAACATGTGAATGAATTCAAATCTATCGAGAAATTCAAGATTTTCAATACCAACAACTTGTGGGCAAATCGGAAGGCCATTAGAAGGCTTGTAGAAGCGAATGCACTGAAAATGGAGATTATCCCAACCCCAAGGATAAAGGTTCTTCCACTTGAAACGGCAGCTGGGGCAGCAATCAGATTTTTTGATAACGCTATTGGAGCGAATGTTCCAAGGTCTTGTTTCCTTCCGGTGAAACCAACGTCTGATTTGCTTCTTAGTTCAGGTATCAGCTTTCTATGTGATTACTCCGATCTATATACCTTGGTAGATGGCTTTGTAGTTCGTAATAAAGCCAGAACAAATTCTGCTAATCACTCAGTTGAACTGGGGCCTGAATTTAAAAAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K00963	UGP2, galU, galF	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Biosynthesis of antibiotics	map01130
		Pentose and glucuronate interconversions	map00040
		Galactose metabolism	map00052
		Starch and sucrose metabolism	map00500
		Amino sugar and nucleotide sugar metabolism	map00520

GO term	Ontology	Name
GO:0070569	Molecular Function	uridylyltransferase activity

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	2.070
SRP064423	SRR2545915	Juvenile tuber	20.010
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00