Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|89894414\|ref\|YP_517901.1\|	2.00E-25	hypothetical protein DSY1668 [Desulfitobacterium hafniense Y51]
KOG	KOG1051	4.00E-29	Chaperone HSP104 and related ATP-dependent Clp proteases
nr	gi\|568884133\|ref\|XP_006494775.1\|	6.68E-31	PREDICTED: chaperone protein ClpB1-like isoform X1 [Citrus sinensis]
Swissprot	tr\|Q6F2Y7\|CLPB1_ORYSJ	2.00E-31	Chaperone protein ClpB1
trEMBL	tr\|I1MT57\|I1MT57_SOYBN	9.00E-31	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA17G08540.1}
TAIR	AT1G74310	4.00E-29	heat shock protein 101

Scaffold	Start	End	Strand
GWHAAEX00000044	552858	553365	+

Transcript Sequence
>GWHTAAEX010855 ATGAGATTCCTGCTTCCAGTTTCCTCACTAAAGCCATTTGTTGCGCTCAATCCTCACAGAAGCGCTCAAAAAACCTACGGCCGAGATCTCGTCGAGCACTCAAGGAAGCTAGATCCGGTGATCGAGCATGACGGAGAGATCCGTCGCGTTGTTCTCATCCTCTCTCGCCAGACCAAGAACAACCCCTTCCTCATCAGTGAACTGGGCGTGGAAAAGATCGTCATCGTTCAGGGCTTGGCTAAGCGGATCGTGAGGGGCGACGTCCCCAGCAATCAGAAGGATGTGAGGCTCATCGCCCTCGACATGGGGCGCTGGTCATTGTAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K03695	clpB	Longevity regulating pathway - multiple species	map04213

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.960
SRP064423	SRR2545915	Juvenile tuber	0.540
SRP108465	SRR5643513	five period of Gastrodia elata	2.740
	SRR5643514	five period of Gastrodia elata	1.080
	SRR5643515	five period of Gastrodia elata	2.530
	SRR5643524	five period of Gastrodia elata	1.060
	SRR5643525	five period of Gastrodia elata	3.000
	SRR5643528	five period of Gastrodia elata	1.430
	SRR5643658	five period of Gastrodia elata	1.090
	SRR5643659	five period of Gastrodia elata	1.070
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.650
	SRR5643663	five period of Gastrodia elata	0.460
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	1.110
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	2.810
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.930
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.720
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	1.770
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	2.680
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	1.960
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	1.980
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	1.980
SRP279888	Gastro	Gastrodia elata tuber	1.19
	Juven	Juvenile tuber	1.32
	Mother_Gastro	Mother tuber of Gastrodia elata	3.08
	Mother_Juven	Mother tuber of Juvenile	0.82