Gene detail

Detail information of GWHGAAEX010918/evm.TU.scaffold_33.106

Functional Annotation

Database	Orthologs	E value	Annotation
COG	gi\|256394919\|ref\|YP_003116483.1\|	2.00E-09	signal transduction protein with EFhand domain [Catenulispora acidiphila DSM 44928]
KOG	KOG0027	4.00E-39	Calmodulin and related proteins (EF-Hand superfamily)
nr	gi\|672173807\|ref\|XP_008807043.1\|	8.65E-57	PREDICTED: calmodulin-like protein 7 [Phoenix dactylifera]
Swissprot	tr\|Q9LX27\|CML4_ARATH	1.00E-39	Calmodulin-like protein 4
trEMBL	tr\|M0TCV5\|M0TCV5_MUSAM	9.00E-52	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr6P35120_001}
TAIR	AT3G59440	4.00E-39	Calcium-binding EF-hand family protein

Location And Transcript Sequence

Scaffold	Start	End	Strand
GWHAAEX00000044	2853421	2854074	-

Transcript Sequence
>GWHTAAEX010918 ATGGCCGCCTTCGTCCTCTTCGCTTTTCTCTTCCTCTGCGGACTGCTCAATTCTCTATTCTTCCCCCATTCCAAATTCCTCCCATGGCTCCGCTCCCTCCTCCTCTCCGCCATCTCCCCTCCCAAATCCAAAGCCAAAACCAAAGATCCTGCCCATACGGGAATCGAATCCCGCGACGAGAACGCCTTGGATCTAAAACCCCTCTTCGCAACCTTCGATACGAACGGCGACGGTCAGATCTCAGCCGCCGAGCTCTCCGACTCCCTTCGCCGGCTCGGCCTCGACGCCTCCAACGACGATCTGGCCTCCATGATGCAAAGGGCTGATTCAAACTGCGACGGCCTCATCGATCTCGACGAATTTCGCCGTCTCTGCGCCTCCATGAATGAATCCTCGCCCGGCACAGGTCCGAATGCCGAAGAAGAGGAGGATCCTGCGCTGAGGGAGGCCTTCGAAGTCTTCGACGGTAATGGAGACGGCATGATCGCTGCGGAGGAGCTCAGGTTAGTGCTCAAAACGCTTCGGCTCAATCAAGGAGACAGCGCTGAGGCTTGCCGCGACATGATCAGCAGGGTTGATTTGGATGGGGATGGGATGATTTGCTTCGACGAATTCAAGAGGATGATGGCGGCCAGTGGATCGAATCCCTTCTGA

Network for GWHGAAEX010918

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
Module4

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.5	EF-hand_7	65	125	1.80E-11
PF13499.5	EF-hand_7	145	209	4.90E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005509	Molecular Function	calcium ion binding

Expression pattern

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	68.130
SRP064423	SRR2545915	Juvenile tuber	102.040
SRP108465	SRR5643513	five period of Gastrodia elata	178.980
	SRR5643514	five period of Gastrodia elata	86.520
	SRR5643515	five period of Gastrodia elata	314.960
	SRR5643524	five period of Gastrodia elata	64.930
	SRR5643525	five period of Gastrodia elata	584.590
	SRR5643528	five period of Gastrodia elata	192.220
	SRR5643658	five period of Gastrodia elata	319.120
	SRR5643659	five period of Gastrodia elata	234.080
	SRR5643660	five period of Gastrodia elata	60.230
	SRR5643661	five period of Gastrodia elata	143.100
	SRR5643662	five period of Gastrodia elata	229.930
	SRR5643663	five period of Gastrodia elata	161.890
	SRR5643664	five period of Gastrodia elata	1029.670
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	517.150
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	486.740
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	397.630
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	381.130
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	325.340
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	339.250
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	453.130
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	363.180
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	194.600
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	455.150
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	360.050
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	360.050
SRP279888	Gastro	Gastrodia elata tuber	182.72
	Juven	Juvenile tuber	30.62
	Mother_Gastro	Mother tuber of Gastrodia elata	562.47
	Mother_Juven	Mother tuber of Juvenile	128.98