Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|435852984\|ref\|YP_007314303.1\|	3.00E-29	30S ribosomal protein S17 [Halobacteroides halobius DSM 5150]
KOG	KOG1740	2.00E-43	Predicted mitochondrial/chloroplast ribosomal protein S17
nr	gi\|643741240\|gb\|KDP46744.1\|	9.72E-50	hypothetical protein JCGZ_06532 [Jatropha curcas]
Swissprot	tr\|P49504\|RR17_ODOSI	1.00E-22	30S ribosomal protein S17, chloroplastic
trEMBL	tr\|A0A067LQC8\|A0A067LQC8_JATCU	4.00E-50	Uncharacterized protein {ECO:0000313\|EMBL:KDP46744.1}
TAIR	AT3G18880	2.00E-43	Nucleic acid-binding, OB-fold-like protein

Scaffold	Start	End	Strand
GWHAAEX00000035	3128532	3143683	-

Transcript Sequence
>GWHTAAEX011663 GAAGAAGTTCCCGGCTTTCTGGCGCTTAAGAATCGGAGGAGATGAAGTCGATAGTGGGTATGGTTGTTTCGAATAAGATGCAGAAATCTGTGGTTGTGGCTGTGGATCGGCTTTTCCACCACAAGCTCTACAAGCGCTACATCAAGCGGACCAGTAAATTCATGGCCCACGACGAGCACAACGAGTGCAACATCGGCGACCGGGTTAGGTTGGATCCCTCAAGGCCTCTTAGCAGACACAAGCACTGGGTTGTTGCGGATATACTTCACCGTGCAAAGATATATGTGCCGCCGCCACGGTCGCCGGCTGCTGATGTTACTCCAACCCAATCATGATTTTGTTGCGCGCTTGAGAAGTGATTGATTGCTCAGACGCTGTTGAAATAGTTTTAGTGCCTCTTTGATTGGGGTTTACATTCTTGAGCACCTTTATTTATTATATGCATTTCCAGAGCATATCTGGCTCTAAAAGAGGTTCTAACACTTACCTTGGATTTTCTCAAAGAAAAGATCATAAAAT

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K02961	RP-S17, MRPS17, rpsQ	Ribosome	map03010

GO term	Ontology	Name
GO:0006412	Biological Process	translation
GO:0003735	Molecular Function	structural constituent of ribosome
GO:0005840	Cellular Component	ribosome

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	19.810
SRP064423	SRR2545915	Juvenile tuber	20.260
SRP108465	SRR5643513	five period of Gastrodia elata	55.730
	SRR5643514	five period of Gastrodia elata	71.350
	SRR5643515	five period of Gastrodia elata	59.250
	SRR5643524	five period of Gastrodia elata	61.870
	SRR5643525	five period of Gastrodia elata	68.140
	SRR5643528	five period of Gastrodia elata	60.170
	SRR5643658	five period of Gastrodia elata	48.700
	SRR5643659	five period of Gastrodia elata	60.490
	SRR5643660	five period of Gastrodia elata	59.900
	SRR5643661	five period of Gastrodia elata	59.600
	SRR5643662	five period of Gastrodia elata	56.450
	SRR5643663	five period of Gastrodia elata	59.650
	SRR5643664	five period of Gastrodia elata	47.450
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	45.980
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	71.850
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	62.860
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	47.560
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	49.280
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	37.350
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	46.290
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	48.900
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	67.380
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	63.820
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	79.780
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	79.780
SRP279888	Gastro	Gastrodia elata tuber	46.44
	Juven	Juvenile tuber	53.59
	Mother_Gastro	Mother tuber of Gastrodia elata	37.76
	Mother_Juven	Mother tuber of Juvenile	29.99