Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|681884021\|gb\|AIM58716.1\|	5.55E-32	bibenzyl synthase [Cymbidium hybrid cultivar]
Swissprot	tr\|P53416\|BBS_PHASS	2.00E-33	Bibenzyl synthase
trEMBL	tr\|A0A088G5Z5\|A0A088G5Z5_9ASPA	2.00E-32	Bibenzyl synthase {ECO:0000313\|EMBL:AIM58716.1}
TAIR	AT5G13930	3.00E-22	Chalcone and stilbene synthase family protein

Scaffold	Start	End	Strand
GWHAAEX00000038	1798182	1798473	+

Transcript Sequence
>GWHTAAEX012086 ATGCAGAGCATTGTAGAATCCATAGGGTGGAAGCAAGCAAGAGCACATGGCTGGGCCTCTATCTTAGCCATCGGAAGGGCAAACCCAGAGAACATCATCGAACAGAGCACCTTTCCCGACTTCTACTTCCGTGTAACCAACAGCGAGCACTTGGTCAATCTCAAGGAGAAACTCCAACGGATATGCGACAAGACAGCGATCAGACAGCGACATTATGCCTGGAATTAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module6

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K00660	CHS	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Flavonoid biosynthesis	map00941
		Circadian rhythm - plant	map04712

GO term	Ontology	Name
GO:0003824	Molecular Function	catalytic activity

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	4.860
SRP064423	SRR2545915	Juvenile tuber	4.160
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	3.180
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	289.270
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	426.020
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	299.170
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	588.560
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	568.100
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	872.440
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	539.380
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	965.480
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	143.920
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	205.620
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	120.860
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	120.860
SRP279888	Gastro	Gastrodia elata tuber	18.76
	Juven	Juvenile tuber	6.15
	Mother_Gastro	Mother tuber of Gastrodia elata	8.52
	Mother_Juven	Mother tuber of Juvenile	0.00