Gene detail

Detail information of GWHGAAEX012374/evm.TU.scaffold_42.204

Functional Annotation

Database	Orthologs	E value	Annotation
COG	gi\|150392083\|ref\|YP_001322132.1\|	6.00E-06	XRE family plasmid maintenance system antidote protein [Alkaliphilus metalliredigens QYMF]
KOG	KOG3398	1.00E-80	Transcription factor MBF1
nr	gi\|743757085\|ref\|XP_010920210.1\|	2.48E-86	PREDICTED: multiprotein-bridging factor 1b-like [Elaeis guineensis]
Swissprot	tr\|Q9LXT3\|MBF1B_ARATH	3.00E-81	Multiprotein-bridging factor 1b
trEMBL	tr\|W1NSB0\|W1NSB0_AMBTC	6.00E-86	Uncharacterized protein {ECO:0000313\|EMBL:ERM97679.1}
TAIR	AT3G58680	1.00E-80	multiprotein bridging factor 1B

Location And Transcript Sequence

Scaffold	Start	End	Strand
GWHAAEX00000050	5384648	5398903	-

Transcript Sequence
>GWHTAAEX012374 ATGGCTGGCGTCGGTCCGATTACGCAAGACTGGGAGCCCATGGTGATGCGCAAAAAGGCTCCAAACGCAGCTGCCAAGAAGGACGAGAAAGCCGTAAACGCCGCCCGGCGGAGCGGCGCGGAAATCGAAACACTGAAGAAGTCTAATGCTGGCACGAACAAAGCAGCATCAAGTAGCACAACATTGAATACAAGAAAACTAGATGAAGAAACAGAAAACCTTTCTCACGAAAAGGTGCCGATGGAGCTGAAGAAGAACATCACGCAAGCCCGAGTGGACAAGAAGCTGACCCAGTCGCAGCTTGCACAGTTGATCAATGAGAAACCTCAGGTGATACAGGAGTACGAATCCGGGAAGGCGATCCCAAATCAGCAGATCATCAACAAACTTGAAAGAGTCCTCGGAGTGAAGCTGCGCGGCAAAAAATGA

Network for GWHGAAEX012374

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08523.9	MBF1	9	79	3.40E-23
PF01381.21	HTH_3	89	138	8.30E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MBF1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	Molecular Function	DNA binding

Expression pattern

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	327.580
SRP064423	SRR2545915	Juvenile tuber	244.390
SRP108465	SRR5643513	five period of Gastrodia elata	205.830
	SRR5643514	five period of Gastrodia elata	202.620
	SRR5643515	five period of Gastrodia elata	208.510
	SRR5643524	five period of Gastrodia elata	205.380
	SRR5643525	five period of Gastrodia elata	569.390
	SRR5643528	five period of Gastrodia elata	594.470
	SRR5643658	five period of Gastrodia elata	502.590
	SRR5643659	five period of Gastrodia elata	251.840
	SRR5643660	five period of Gastrodia elata	307.690
	SRR5643661	five period of Gastrodia elata	287.180
	SRR5643662	five period of Gastrodia elata	326.810
	SRR5643663	five period of Gastrodia elata	282.090
	SRR5643664	five period of Gastrodia elata	334.490
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	218.880
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	210.970
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	229.840
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	241.070
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	276.410
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	299.360
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	247.500
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	256.110
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	233.110
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	255.020
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	262.140
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	262.140
SRP279888	Gastro	Gastrodia elata tuber	421.11
	Juven	Juvenile tuber	289.57
	Mother_Gastro	Mother tuber of Gastrodia elata	339.57
	Mother_Juven	Mother tuber of Juvenile	301.70