Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|661879867\|emb\|CDP16467.1\|	4.71E-28	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q84TH6\|DIR23_ARATH	9.00E-27	Dirigent protein 23 (Precursor)
trEMBL	tr\|A0A068V7D4\|A0A068V7D4_COFCA	2.00E-28	Coffea canephora
TAIR	AT5G42510	1.00E-25	Disease resistance-responsive (dirigent-like protein) family protein

Scaffold	Start	End	Strand
GWHAAEX00000045	5265248	5266022	+

Transcript Sequence
>GWHTAAEX012667 ATTATTGCTAATTTGATTCGTAGTAGTCACATATCTCTCTTTGAGCATCTATGGTGGCATTCCCTTGCTATATTATTGTTTTGGGTGCTTTGGCGCTATCGTTTCGATCAATAGCTATTGAAGCTGCTTCTGAGATTGAAAATCAACATCTGCAGAAAACTCACATCCGTTTCTTCTGGCAAGAAAAAATTGGTGGCCCAAATACTACAACAATACAGCTAGTGCAAGGAGAGAATCCGAATATCCTTTTAAGTTTTGGACAAACATTCGCAGGTAATATTCATTTGACTGAAAATTCTAGCCCCTCATCCAAGTCAATTGGACATAGCCAAGGAATTGCCACTGTTGTATCTCAAACTCAAAGCGTCAACGATACGGTCTTCCAACATAGCATAAACATTGTGTTCAATGAGGGAATATACGATGAGAGCACAATTGCGGTTTTTGGGAAGAATTGCATAGGCGACAAGGTTCGTGAGCTTCCTATTGTTGGTGGGACAGGCATGTTTAGAATGGCTCGAGGCTATATACTTTTGAGGACTGTTTTATTTGATGTTAAAGCTGGTATAGGTGGTCATAATATTCTAGAGGAAAATGATTTCTCCCCCTAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module2

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.000
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	11.710
	SRR5643514	five period of Gastrodia elata	11.980
	SRR5643515	five period of Gastrodia elata	6.540
	SRR5643524	five period of Gastrodia elata	10.890
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	5.270
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	17.700
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	11.590
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	2.260
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.330
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	3.210
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	9.840
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	13.660
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	23.210
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	23.210
SRP279888	Gastro	Gastrodia elata tuber	0.06
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	2.15
	Mother_Juven	Mother tuber of Juvenile	4.02