Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|734420805\|gb\|KHN41001.1\|	5.79E-30	Putative B3 domain-containing protein [Glycine soja]
Swissprot	tr\|Q5KQI4\|Y5814_ORYSJ	5.00E-28	B3 domain-containing protein Os05g0481400
trEMBL	tr\|K7KAD2\|K7KAD2_SOYBN	1.00E-30	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA02G40400.5}
TAIR	AT3G19180_2	7.00E-24	Unannotated protein

Scaffold	Start	End	Strand
GWHAAEX00000049	2349111	2356234	-

Transcript Sequence
>GWHTAAEX012950 ATGAAATTTTGCAAGGAGCATCTGCCTAATGGTGTAATTACGATGGTCTTAGAAGATGAAAAGGGTGATGAACAAGAATCCGTCTATATCTCAAATCGTGCGGGACTTAGTGGTGGGTGGAAAAGCTTTGCGGTGGATCACAATTTGGAAGATGGAGATGCTTTGGTATTCAAGTTGATTAAACAAACCAGATTTAAGATATACATTATAAGGGCTTCTGGGAGCTCACCTGTAGCAAAGGATAACAAAGAGAAAGAAGCTACAGAAAATGGGTCAGCAGTGCAAGCCAGAAGTGCAGGGAAGAGAAAGAAGAGAACAAGTTCTTTTAACAGTGTTTTATGCACAGAGATTCTATATTAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module4

Gene family	subfamily
Transcription Factors Family	B3

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0003677	Molecular Function	DNA binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	8.910
SRP064423	SRR2545915	Juvenile tuber	11.400
SRP108465	SRR5643513	five period of Gastrodia elata	0.510
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.470
	SRR5643524	five period of Gastrodia elata	0.400
	SRR5643525	five period of Gastrodia elata	5.350
	SRR5643528	five period of Gastrodia elata	3.150
	SRR5643658	five period of Gastrodia elata	3.990
	SRR5643659	five period of Gastrodia elata	3.610
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	1.350
	SRR5643662	five period of Gastrodia elata	0.950
	SRR5643663	five period of Gastrodia elata	1.030
	SRR5643664	five period of Gastrodia elata	1.680
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	2.740
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	3.870
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	5.070
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	6.620
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	1.020
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	4.360
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	5.640
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	2.300
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	11.020
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	11.020
SRP279888	Gastro	Gastrodia elata tuber	23.57
	Juven	Juvenile tuber	1.78
	Mother_Gastro	Mother tuber of Gastrodia elata	31.07
	Mother_Juven	Mother tuber of Juvenile	7.72