Gene detail

Database	Orthologs	E value	Annotation

Scaffold	Start	End	Strand
GWHAAEX00000066	1904588	1919846	-

Transcript Sequence
>GWHTAAEX014065 ATGGTGAAGCGATCGGCAGGGAAAGCGCATCAAGCCGGTTCTGACAGCTTGCTAACATTCTGCATCTTCTATGAGCTATGTCAACTTTACTTCCCGCCACCACACAAAGCATACAGCATCTTCGTCTTTCCCTGCAAGGGCGCTTTGTATGGCCTTCATCGTGGAGCAAAAAATGTGGGCACCCTAGGAAAAGATGCGATGAGTCACCAGATTGACGGATTGAGCAGAGCTCGATGGGCTACTTGGAAATGCAAATGGGTGTTGACGGACCAGCTGGGATTGCGACGTTCATGGGGCGGGAGTCAGTTAGAGGAGACGAATCCATTGGTTACTGCTTTCCCCAATTGTGACGAGGAAAGCAATGATGATTTAGTTGGTTATTTAAGGCTTTCTCTTCGAATCGGCTTTAAAGCATGTTTTTGGCAACTCAGAGATATTGATGTTGAGAGATGCACGGGAGGATGGACCGTTTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K12581	CNOT7_8, CAF1, POP2	RNA degradation	map03018

GO term	Ontology	Name
GO:0003676	Molecular Function	nucleic acid binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	1.670
SRP064423	SRR2545915	Juvenile tuber	1.340
SRP108465	SRR5643513	five period of Gastrodia elata	0.280
	SRR5643514	five period of Gastrodia elata	0.210
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.940
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.430
	SRR5643659	five period of Gastrodia elata	0.450
	SRR5643660	five period of Gastrodia elata	1.240
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	1.270
	SRR5643663	five period of Gastrodia elata	0.380
	SRR5643664	five period of Gastrodia elata	0.460
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	1.790
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.340
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	1.760
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	1.130
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	1.100
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	1.290
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	1.200
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	1.580
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	1.770
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	1.35
	Juven	Juvenile tuber	0.87
	Mother_Gastro	Mother tuber of Gastrodia elata	1.57
	Mother_Juven	Mother tuber of Juvenile	0.60