Gene detail

Database	Orthologs	E value	Annotation
KOG	KOG3317	2.00E-36	Translocon-associated complex TRAP, beta subunit
nr	gi\|672134841\|ref\|XP_008791075.1\|	8.43E-43	PREDICTED: translocon-associated protein subunit beta [Phoenix dactylifera]
trEMBL	tr\|M0S9Y8\|M0S9Y8_MUSAM	2.00E-42	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr2P21470_001}
TAIR	AT5G14030	2.00E-36	translocon-associated protein beta (TRAPB) family protein

Scaffold	Start	End	Strand
GWHAAEX00000066	3846566	3846961	-

Transcript Sequence
>GWHTAAEX014124 ATGGTGCTTGCTAGTTCCGACGCACCCTTCATGGTGGTGATCAAGAGGGTGAGCCAATCTCAACTCAAATTAGGCGTAGAGCGGTTGACCGTATCAATCGATATCTTCAATCAAGGATCTGTGACTGCCTTTGATGTGAGACTTACTGATGATAGCTGGCCTCAAGATAAATTTGAGGTTGTGACGGGCAGCACTTCAAAGGCACAGGAACGGCTTGATGGAGGCGCGTCTATGTCTCATTCATTTGTTTTGGAGTCAATGGTGAAGGGCACTTTCCAAGATTCTCCTACTCTTATCAAGTTTCGTGTTCCAACAAAACTGTATTACAGGAAGCTTATTCCACTCCCATTCAACTTCTTGATATTATTACTGACAAGCCTCAAGAGAAGAAGTTAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K13250	SSR2	Protein processing in endoplasmic reticulum	map04141

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.000
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00