Gene detail

Database	Orthologs	E value	Annotation
KOG	KOG1543	6.00E-20	Cysteine proteinase Cathepsin L
nr	gi\|357446977\|ref\|XP_003593764.1\|	2.78E-22	Cysteine proteinase [Medicago truncatula]
Swissprot	tr\|O65039\|CYSEP_RICCO	4.00E-18	Vignain (Precursor)
trEMBL	tr\|G7ILI4\|G7ILI4_MEDTR	1.00E-22	Papain family cysteine protease {ECO:0000313\|EMBL:AES64014.2}
TAIR	AT3G49340	6.00E-20	Cysteine proteinases superfamily protein

Scaffold	Start	End	Strand
GWHAAEX00000068	1430230	1431116	-

Transcript Sequence
>GWHTAAEX014325 ATGATTAAATTTAAGTATATCATCGTCATACATTTCATCTTCATCTGCTGCTACATATATCTCAAGTACAAGCACGTCTCCGAATCATTCATTAGCTACCGTAATGTCGACTTGCGCGGCCTCATCGCGTACGTCGATTGGAGAGAGAACGGTGCCGTCACTGATGTTAAGAACCAGGGCAAATGCGTCGCCGTCATTGACATTTACGAACTGATTACAGAGCAGGACGAGACCGCCCTCTTGAAGGTCGTCGCCCATCAGCCCGTCTTTGTCATCGTTGCAACCAATAGCTCAGCTTTTCATCGATATACAGGGATATTCAATCATGGACTTTATAAGGGCGAATGCGGACCAAATATTGATCATGCTATGACCGTCATCGGCTACGAGGTGGATCAGGACGGAATAACAAAGTATTGGCTTCTGAAAAACTCGTGGGGGCAGGTTGGGGCGAAGGCAATGAAAATGTATTTATTGCCACTGAAAAAGTATAGATGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module1

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0006508	Biological Process	proteolysis
GO:0008234	Molecular Function	cysteine-type peptidase activity

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	1.760
SRP064423	SRR2545915	Juvenile tuber	2.230
SRP108465	SRR5643513	five period of Gastrodia elata	2.290
	SRR5643514	five period of Gastrodia elata	2.130
	SRR5643515	five period of Gastrodia elata	2.600
	SRR5643524	five period of Gastrodia elata	1.850
	SRR5643525	five period of Gastrodia elata	2.240
	SRR5643528	five period of Gastrodia elata	3.370
	SRR5643658	five period of Gastrodia elata	4.700
	SRR5643659	five period of Gastrodia elata	2.450
	SRR5643660	five period of Gastrodia elata	2.490
	SRR5643661	five period of Gastrodia elata	2.740
	SRR5643662	five period of Gastrodia elata	1.840
	SRR5643663	five period of Gastrodia elata	1.550
	SRR5643664	five period of Gastrodia elata	1.890
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	1.070
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.610
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.900
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	1.410
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.440
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	1.280
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	1.280
SRP279888	Gastro	Gastrodia elata tuber	0.17
	Juven	Juvenile tuber	0.60
	Mother_Gastro	Mother tuber of Gastrodia elata	0.71
	Mother_Juven	Mother tuber of Juvenile	0.86