Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|672168075\|ref\|XP_008804023.1\|	4.17E-19	PREDICTED: uncharacterized protein LOC103717422 [Phoenix dactylifera]
trEMBL	tr\|M0SXW5\|M0SXW5_MUSAM	4.00E-14	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr5P12360_001}

Scaffold	Start	End	Strand
GWHAAEX00000068	4874187	4883402	-

Transcript Sequence
>GWHTAAEX014474 ATGGCGAATGACGAGGGGGATGAGAAACTGATCGAGGCGCTTGAGAAGGAAGTGAAAGAGATGGCTAAAAAAATCGTCGATTTCCGGTGTTCCATCCCGAAAAGACTCGATGAGATAGTCTCGTCCTCTAATCTCGCCTTGGTGAGGCCAAAGCTTTCTTCGGCGCTGATAACCGCGGATTCTCAGCTTACCGGAAGCGAGAGCAGCTCCCATTATGTGAATGAAACCTCAGATGAAAAGGAGCACGAGAAGCTAAACCTTATTAGGGAGAAAGCTCTTAGCAACGTTGCCGCGGCACCCCTCGTCCTCAAAAGAGTGAACGAATGCCTCGAGAGGATCAGCGAAATCGAGCATATTTATAAAGAAGTGAGGCTAATGCATTCTTCTTTCAAGAGGAGAAAGAAATAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module3

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	12.570
SRP064423	SRR2545915	Juvenile tuber	15.950
SRP108465	SRR5643513	five period of Gastrodia elata	29.440
	SRR5643514	five period of Gastrodia elata	31.340
	SRR5643515	five period of Gastrodia elata	29.030
	SRR5643524	five period of Gastrodia elata	24.980
	SRR5643525	five period of Gastrodia elata	77.140
	SRR5643528	five period of Gastrodia elata	43.010
	SRR5643658	five period of Gastrodia elata	62.450
	SRR5643659	five period of Gastrodia elata	42.070
	SRR5643660	five period of Gastrodia elata	45.660
	SRR5643661	five period of Gastrodia elata	45.430
	SRR5643662	five period of Gastrodia elata	60.620
	SRR5643663	five period of Gastrodia elata	43.940
	SRR5643664	five period of Gastrodia elata	67.420
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	25.060
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	23.300
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	23.440
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	23.830
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	19.010
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	16.730
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	15.560
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	21.660
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	20.920
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	17.940
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	33.530
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	33.530
SRP279888	Gastro	Gastrodia elata tuber	71.01
	Juven	Juvenile tuber	60.24
	Mother_Gastro	Mother tuber of Gastrodia elata	34.47
	Mother_Juven	Mother tuber of Juvenile	20.62