Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|695017462\|ref\|XP_009395670.1\|	3.64E-30	PREDICTED: transcription repressor OFP12-like [Musa acuminata subsp. malaccensis]
Swissprot	tr\|F4I8R6\|OFP12_ARATH	8.00E-15	Transcription repressor OFP12
trEMBL	tr\|M0SLX5\|M0SLX5_MUSAM	1.00E-30	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr4P07580_001}
TAIR	AT1G05420	3.00E-14	ovate family protein 12

Scaffold	Start	End	Strand
GWHAAEX00000005	4699240	4699587	-

Transcript Sequence
>GWHTAAEX015676 ATGCCTTCATCCAAAAGCCTAACCCTAGACGATTCTGATCCGGTTTATTCAGCATTATCCTCAGGCCGCCTATCCCCGGCCTTTCCGGGTCGATCCAACTCCATCATGGACTCCTCCGCGATCTTCATCGGCATCGCCGGTGCCGCCAAAGCGATTCCGACGTACTCGCCGGAACCCTACTTGGATTTCCGGCGATCCATAGAAGAGATGGTGGCGGCGCTCAGCGCCGGTGCTCCCCTCGACCTTGCCGTCCTCCGCGACCTCCTTCTCTGCTATCTCGTCCTCAATCCCAGGGACGCGCACCAGTGTATCGTCACCGCCTTCACAGATCTCCTCCTAAGTCTTTAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
Transcription Factors Family	OFP

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	15.320
SRP064423	SRR2545915	Juvenile tuber	3.280
SRP108465	SRR5643513	five period of Gastrodia elata	7.800
	SRR5643514	five period of Gastrodia elata	7.400
	SRR5643515	five period of Gastrodia elata	5.140
	SRR5643524	five period of Gastrodia elata	10.880
	SRR5643525	five period of Gastrodia elata	3.020
	SRR5643528	five period of Gastrodia elata	5.770
	SRR5643658	five period of Gastrodia elata	1.750
	SRR5643659	five period of Gastrodia elata	3.500
	SRR5643660	five period of Gastrodia elata	3.960
	SRR5643661	five period of Gastrodia elata	4.430
	SRR5643662	five period of Gastrodia elata	6.760
	SRR5643663	five period of Gastrodia elata	7.890
	SRR5643664	five period of Gastrodia elata	3.230
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	10.830
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	24.570
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	4.930
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	8.680
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	5.010
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.740
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	6.800
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.690
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	3.150
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	3.080
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	5.660
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	5.660
SRP279888	Gastro	Gastrodia elata tuber	2.16
	Juven	Juvenile tuber	4.26
	Mother_Gastro	Mother tuber of Gastrodia elata	9.41
	Mother_Juven	Mother tuber of Juvenile	7.04