Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|186683200\|ref\|YP_001866396.1\|	1.00E-26	signal transduction protein [Nostoc punctiforme PCC 73102]
KOG	KOG0027	5.00E-63	Calmodulin and related proteins (EF-Hand superfamily)
nr	gi\|672175901\|ref\|XP_008808019.1\|	3.82E-72	PREDICTED: calmodulin-like [Phoenix dactylifera]
Swissprot	tr\|O82018\|CALM_MOUSC	1.00E-64	Calmodulin
trEMBL	tr\|M0TDS9\|M0TDS9_MUSAM	8.00E-68	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr7P01390_001}
TAIR	AT4G14640	5.00E-63	calmodulin 8

Scaffold	Start	End	Strand
GWHAAEX00000069	3478797	3480158	-

Transcript Sequence
>GWHTAAEX015895 ATGGATCGCGTCACAGAAGAGCTTATACATGAGTTCCAGAATGCCTTCAATCTCATAGACAAGGATGAAGATGGCCGTATAACCGTGGAGGAGCTCGCAGCTGTTGTGGGATCGTTAGGGCAAAACCCATCTGAAGAAGAATTGAAGGATGTAATTGATGAAGTAGATTTGAATAGAAACAATATGGTTGAATTCGGAGAGCTCTTAAGCCTAATGACACAAAAATTGAAGGAGACAGATGCAGAAGAAGAACTGAAGGAGTGTTTCAAGGTTTTTGACAAAGATCAAGATGGTTATATCTCAGCCACTGAGTTAAAAAATGTGATGATCAATCTTGGAGAGAAATTAACAGATGAAGAGGTTAATCAAATGATCAGAGAAGCAGATATGGATGGTGATGGGAAAGTCAACTATGAGGAATTTGTGATGATGATGATGGCATTTTGATTGAGGCAACTCTTTTTTTTTCTTTTTTTTTT

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module2

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.5	EF-hand_7	13	72	4.90E-12
PF13499.5	EF-hand_7	82	145	9.20E-17

Protein Sequence

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

GO term	Ontology	Name
GO:0005509	Molecular Function	calcium ion binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.470
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	0.270
	SRR5643514	five period of Gastrodia elata	0.620
	SRR5643515	five period of Gastrodia elata	0.250
	SRR5643524	five period of Gastrodia elata	0.880
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.280
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.220
	SRR5643660	five period of Gastrodia elata	0.970
	SRR5643661	five period of Gastrodia elata	0.240
	SRR5643662	five period of Gastrodia elata	0.250
	SRR5643663	five period of Gastrodia elata	0.190
	SRR5643664	five period of Gastrodia elata	0.680
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.870
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	1.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	2.940
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.220
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.540
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.630
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	2.620
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	4.090
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	3.080
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	11.240
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	3.820
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	3.820
SRP279888	Gastro	Gastrodia elata tuber	0.21
	Juven	Juvenile tuber	0.27
	Mother_Gastro	Mother tuber of Gastrodia elata	0.58
	Mother_Juven	Mother tuber of Juvenile	0.65