Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|645267387\|ref\|XP_008239046.1\|	1.62E-07	PREDICTED: probable polygalacturonase [Prunus mume]
trEMBL	tr\|M5W9C6\|M5W9C6_PRUPE	6.00E-08	Uncharacterized protein {ECO:0000313\|EMBL:EMJ10342.1}
TAIR	AT4G23820	5.00E-07	Pectin lyase-like superfamily protein

Scaffold	Start	End	Strand
GWHAAEX00000070	4503214	4503370	-

Transcript Sequence
>GWHTAAEX016318 ATGCGGGCGGAAACGATATCGCTCGTGGATTTTGGAGTTGGAGATGGTGTGACGCTGAATACGAAGGCGTTTAATGATCCGATATATCGAATTGAGCACCTGAAACTCCCACCGGAACGCTCATCTACGTTCCCAATGGAGCCTGGCTCACCGGAAC

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module1

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	50.040
SRP064423	SRR2545915	Juvenile tuber	15.920
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	538.390
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	3633.250
	SRR5643528	five period of Gastrodia elata	738.410
	SRR5643658	five period of Gastrodia elata	670.690
	SRR5643659	five period of Gastrodia elata	442.350
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	636.940
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	33.330
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	30.870
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	29.030
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	15.160
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	15.160
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	813.53