Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|374993549\|ref\|YP_004969048.1\|	2.00E-06	acetyl-CoA acetyltransferase [Desulfosporosinus orientis DSM 765]
KOG	KOG1389	3.00E-11	3-oxoacyl CoA thiolase
nr	gi\|645493221\|gb\|AIB06952.1\|	5.48E-14	3-ketoacyl-CoA thiolase [Vanda hybrid cultivar]
Swissprot	tr\|Q8LF48\|THIK1_ARATH	8.00E-12	3-ketoacyl-CoA thiolase 1, peroxisomal (Precursor)
trEMBL	tr\|A0A075E3G4\|A0A075E3G4_9ASPA	2.00E-14	3-ketoacyl-CoA thiolase {ECO:0000313\|EMBL:AIB06952.1}
TAIR	AT1G04710	3.00E-11	peroxisomal 3-ketoacyl-CoA thiolase 4

Scaffold	Start	End	Strand
GWHAAEX00000072	3638320	3640557	+

Transcript Sequence
>GWHTAAEX016403 ATGGTTATAATTGATGTCTCTATTGAGATGAATGCTGCTATTGATGTTGTCCCAATGGTTACAAATGTTGTCCCAATCATGGATCCAAAAATTGGAGCTGAGAATGAAATTACTGTCTCTATTGATGAGGGAATTCGCCCAGAAACATCCTTGTTAGGACGTGCAAAACTCAAACCTGCATTTAAGAAGGGTGGAAGCACCACCGCAAGTTCTAAAGGCCTGATTTTTGTGAAATTCTCCAAGAGGCGGAATGGAATCATGAAGAAGGCGAAGGAGAACAGCGTTCTTTGTGATGCCCAGATCCCTATGGACAGGTAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00108.22	Thiolase_N	21	71	3.00E-06
PF00319.17	SRF-TF	77	101	2.70E-09

Protein Sequence

Gene family	subfamily
Transcription Factors Family	MADS-M-type

KO	Enzyme	pathway	mapID
K07513	ACAA1	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Biosynthesis of antibiotics	map01130
		Fatty acid metabolism	map01212
		Fatty acid degradation	map00071
		alpha-Linolenic acid metabolism	map00592
		Biosynthesis of unsaturated fatty acids	map01040
		Cysteine and methionine metabolism	map00270
		Peroxisome	map04146
		PPAR signaling pathway	map03320

GO term	Ontology	Name
GO:0046983	Molecular Function	protein dimerization activity
GO:0003677	Molecular Function	DNA binding
GO:0003824	Molecular Function	catalytic activity
GO:0016747	Molecular Function	transferase activity, transferring acyl groups other than amino-acyl groups

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	8.510
SRP064423	SRR2545915	Juvenile tuber	4.540
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	3.380
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.950
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.700
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	3.18
	Mother_Juven	Mother tuber of Juvenile	0.00