Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|16129304\|ref\|NP_415859.1\|	1.00E-07	ATP-dependent RNA helicase, specific for 23S rRNA [Escherichia coli str. K-12 substr. MG1655]
KOG	KOG0329	2.00E-21	ATP-dependent RNA helicase
nr	gi\|527183291\|gb\|EPS57760.1\|	5.35E-22	hypothetical protein M569_17057, partial [Genlisea aurea]
Swissprot	tr\|Q0JM17\|RH56_ORYSJ	3.00E-22	DEAD-box ATP-dependent RNA helicase 56
trEMBL	tr\|S8BT19\|S8BT19_9LAMI	2.00E-22	Uncharacterized protein {ECO:0000313\|EMBL:EPS57760.1} (Fragment)
TAIR	AT5G11200	2.00E-21	DEAD/DEAH box RNA helicase family protein

Scaffold	Start	End	Strand
GWHAAEX00000086	447033	450184	+

Transcript Sequence
>GWHTAAEX016598 ATGGTGATGTTCATATTTTGGTTATACACCAGTACAACACGAGTGCATACCTCAAGCTATTTTGGAATGGACGTCAGTTGTCAAGCAAAGTCTGGAATGGGGAAAACTGCTATTTTTGTTCTCTCAACTCTTCAACAAATAGAGCCCATCGCTGGTCAAATTGCGGCTCTTGTTTTCTGTCATACCAGGGAATTGGCTTACCAGGCGTCGGGTGTCGGGCCTCGGGAGAGGGTCGAGCGAACGGCCGAGCGAGGAGAAGGCGTCGGAAGGGGAAGCGTCGAGCGAGGAGAAGGCGTCTGGCGTCGGGGAAGCGTCGAGCGAACAGCTGAGCGAGGCGTCGGGCTTCTTGCGAGCGGCTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K12812	DDX39B, UAP56, SUB2	Spliceosome	map03040
		RNA transport	map03013
		mRNA surveillance pathway	map03015

GO term	Ontology	Name
GO:0003676	Molecular Function	nucleic acid binding
GO:0005524	Molecular Function	ATP binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	3.480
SRP064423	SRR2545915	Juvenile tuber	4.380
SRP108465	SRR5643513	five period of Gastrodia elata	0.510
	SRR5643514	five period of Gastrodia elata	0.400
	SRR5643515	five period of Gastrodia elata	1.880
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.670
	SRR5643528	five period of Gastrodia elata	0.530
	SRR5643658	five period of Gastrodia elata	0.400
	SRR5643659	five period of Gastrodia elata	0.800
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.450
	SRR5643662	five period of Gastrodia elata	0.470
	SRR5643663	five period of Gastrodia elata	1.720
	SRR5643664	five period of Gastrodia elata	2.530
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.750
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.550
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.970
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	1.320
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	1.520
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	2.490
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	1.880
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.920
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	1.15
	Juven	Juvenile tuber	0.76
	Mother_Gastro	Mother tuber of Gastrodia elata	1.97
	Mother_Juven	Mother tuber of Juvenile	0.00