Gene detail

Database	Orthologs	E value	Annotation
KOG	KOG2214	3.00E-30	Predicted esterase of the alpha-beta hydrolase superfamily
nr	gi\|743786505\|ref\|XP_010922190.1\|	1.29E-36	PREDICTED: triacylglycerol lipase SDP1-like [Elaeis guineensis]
Swissprot	tr\|Q9LZA6\|SDP1_ARATH	1.00E-30	Triacylglycerol lipase SDP1
trEMBL	tr\|M0SEM1\|M0SEM1_MUSAM	1.00E-36	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr3P14540_001}
TAIR	AT5G04040	3.00E-30	Patatin-like phospholipase family protein

Scaffold	Start	End	Strand
GWHAAEX00000004	2105706	2107147	-

Transcript Sequence
>GWHTAAEX016992 ATGGCAAAGGATAGATTTGGAGAGCTTGTACCTTTTGATGCATCAATTTCAGGGGGCCAGACCAGTCATCGTCTGCAGCTTCTGCTAGGCTCTGGAGGGATGGCAATTTGGAAATACTCAAAAATCATACAAAATTCATCATATGCGGAGCTCCAAAAGACTGTCAACCAAGGCAAACGATGCACCTGGGAGAAGCTCTCTGCCATTGCGTTGGATGAATGCGTAGCCCTTCTCAACCACATGTGGAGGCTAAAGGGAAGTCCAGAGAGAGCCACTGCTTCTCACGGCTGTGCTGGCACCATCAAATTCAGTGCCACTTGCAGAATCCCACCATGGAATTGTATTGCTAGGGAGAACTCATGGGGCTCGCTGGACAAAAAGATCCCGGTTGATGCCAACACTGCAAACCATTTGGGAACGAGCCAATAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K14674	TGL4	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Steroid biosynthesis	map00100
		Glycerolipid metabolism	map00561
		Glycerophospholipid metabolism	map00564
		Ether lipid metabolism	map00565
		Arachidonic acid metabolism	map00590
		Linoleic acid metabolism	map00591
		alpha-Linolenic acid metabolism	map00592

GO term	Ontology	Name

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.000
SRP064423	SRR2545915	Juvenile tuber	0.320
SRP108465	SRR5643513	five period of Gastrodia elata	1.700
	SRR5643514	five period of Gastrodia elata	2.860
	SRR5643515	five period of Gastrodia elata	1.570
	SRR5643524	five period of Gastrodia elata	0.540
	SRR5643525	five period of Gastrodia elata	4.760
	SRR5643528	five period of Gastrodia elata	1.740
	SRR5643658	five period of Gastrodia elata	3.680
	SRR5643659	five period of Gastrodia elata	0.810
	SRR5643660	five period of Gastrodia elata	2.410
	SRR5643661	five period of Gastrodia elata	3.030
	SRR5643662	five period of Gastrodia elata	1.860
	SRR5643663	five period of Gastrodia elata	2.300
	SRR5643664	five period of Gastrodia elata	1.400
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	2.680
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.440
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	4.210
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.580
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	1.740
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.310
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	2.280
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	2.580
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.280
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	3.230
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	3.230
SRP279888	Gastro	Gastrodia elata tuber	1.42
	Juven	Juvenile tuber	2.43
	Mother_Gastro	Mother tuber of Gastrodia elata	3.14
	Mother_Juven	Mother tuber of Juvenile	3.53