Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|385806402\|ref\|YP_005842800.1\|	5.00E-08	replication factor C small subunit [Fervidicoccus fontis Kam940]
KOG	KOG0989	4.00E-14	Replication factor C, subunit RFC4
nr	gi\|30687479\|ref\|NP_849695.1\|	3.67E-14	replication factor C subunit 4 [Arabidopsis thaliana]
Swissprot	tr\|Q93ZX1\|RFC4_ARATH	9.00E-15	Replication factor C subunit 4
trEMBL	tr\|F4HY46\|F4HY46_ARATH	1.00E-14	Protein embryo defective 1968 {ECO:0000313\|EMBL:AEE30140.1}
TAIR	AT1G21690	4.00E-14	ATPase family associated with various cellular activities (AAA)

Scaffold	Start	End	Strand
GWHAAEX00000080	2438496	2439170	-

Transcript Sequence
>GWHTAAEX017621 ATGAAGACCTCACATTCCTGCCGACATTTCCTCCTTTTAATCTTGAAGAAGGAGCTTACTGAGAACAAGGAGCTCACTGAGAAGAAGGAGCCTCCCCAAGCTTCTTCTTCCTCTTTTCTTCTTTCGAATCGCCTTTTGTCCGTTCTTGGAGCACCTCCTATTGCGCTTGTCTCAGCGTTTCTGCCTTGGAATAGGATGAAGAGAAGGTGCTTCCTTAATCTTGAGACTGTTGCGCAAGTTAAGGACGTAGCCCAGCAGGAGGAGTGTCCTCATATGCTCTTCTATGGAACTCCCGGAACGGGTAAGACCACAACGGCTTTAGCCATCGTGCACCAGTTATTTGGGTAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K10755	RFC2_4	DNA replication	map03030
		Nucleotide excision repair	map03420
		Mismatch repair	map03430

GO term	Ontology	Name
GO:0005524	Molecular Function	ATP binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.410
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.720
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	2.540
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	1.250
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	0.29
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00