Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|262194545\|ref\|YP_003265754.1\|	3.00E-22	cytochrome P450 [Haliangium ochraceum DSM 14365]
KOG	KOG0156	6.00E-60	Cytochrome P450 CYP2 subfamily
nr	gi\|672205193\|ref\|XP_008779115.1\|	5.95E-73	PREDICTED: cytochrome P450 71A1-like [Phoenix dactylifera]
Swissprot	tr\|A3A871\|C71Z6_ORYSJ	3.00E-62	Ent-isokaurene C2-hydroxylase
trEMBL	tr\|M1BY53\|M1BY53_SOLTU	4.00E-63	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400055558}
TAIR	AT3G26210	6.00E-60	cytochrome P450, family 71, subfamily B, polypeptide 23

Scaffold	Start	End	Strand
GWHAAEX00000080	2480498	2481046	-

Transcript Sequence
>GWHTAAEX017622 ATGCGAAATAAATCGGCGATGAAGAAATCGCAAGATGAGATTCGAAAAGTTGTTGGAAATAAAGGAAGAGTTGAAGAGGATGATCTAAAATACTTTCATTATCTCAAGTTAGTGATTAAGGAGACGTTAAGATTGCATAATCCCGCTCCTCTGTTAGCACCACACGAATGTATAAGAGATACAAATATAAGCAACTATGATATTCCAGCAAAGACATGGGTTGTCATCAACATTAGAGCAATCAGTAGAGATCCTCAGTTATGGGAAAATCTAGAGGTCTTTGATCCAGAAAGATTTGAGAATAGCTCCATCACTTACAATGGCGATCATTTTGTGTTCATACCATTTGGTTCAGGTCGAAGGATCTGTCCTGGAATGACCTTAGTCATAGTCAATGTTGAGATTGCTCTAGCAAACCTTTTGTACGGATTTGAGTGGAAGTTGCCTTATGGAATGGATGAAAAGGATATCGATATCCAAGAGAATTTGGGCATTGTGGCTGCAAAGAAGATTCTGCTCAAGTTATTAGCCATTGTTGCACAAGTCTAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module8

Gene family	subfamily
Cytochrome P450 Family	CYP71B23

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0055114	Biological Process	oxidation-reduction process
GO:0005506	Molecular Function	iron ion binding
GO:0016705	Molecular Function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	Molecular Function	heme binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	43.220
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	0.430
	SRR5643514	five period of Gastrodia elata	0.490
	SRR5643515	five period of Gastrodia elata	0.600
	SRR5643524	five period of Gastrodia elata	0.350
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	5.190
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	2.970
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	6.340
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	9.310
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	6.090
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	2.150
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	5.540
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	8.990
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	4.460
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.970
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	3.080
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	3.080
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	6.63
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.99