Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|428204055\|ref\|YP_007082644.1\|	8.00E-68	acetyl-CoA carboxylase, carboxyl transferase subunit beta [Pleurocapsa sp. PCC 7327]
KOG	KOG0540	2.00E-88	3-Methylcrotonyl-CoA carboxylase, non-biotin containing subunit/Acetyl-CoA carboxylase carboxyl transferase, subunit beta
nr	gi\|482662341\|gb\|AGK25566.1\|	1.41E-98	acetyl-CoA carboxylase carboxyl transferase beta (chloroplast) [Cymbidium mannii]
Swissprot	tr\|A6MML6\|ACCD_DIOEL	5.00E-97	Acetyl-coenzyme A carboxylase carboxyl transferase subunit beta, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01395}
trEMBL	tr\|M9YYT6\|M9YYT6_9ASPA	5.00E-99	Acetyl-coenzyme A carboxylase carboxyl transferase subunit beta, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01395}
TAIR	ATCH032	2.00E-88	Unannotated protein

Scaffold	Start	End	Strand
GWHAAEX00000083	1070352	1070858	+

Transcript Sequence
>GWHTAAEX017661 ATGGGGGTGATGGACTTTCAATTTATGGGAGGTAGCATGGGTTCTGTAGTAGGGGAGAAGATTACTCGTTTGATCGAATATGCTACTAAACAATCATTACCTGTAATTATTATATGTGCTTCCGGAGGAGCACGCATGCAAGAAGGTAGTTTGAGTTTAATGCAAATGGCTAAGATCTCTTCTGTTTTATATGATTATCAATTAAATAACAAGTTCTTTTATATATCAATTCTTACATCTCCTACAACCGGAGGAGTTACAGCTAGTTTTGGTATGTTGGGAGATGTTATTATTGTTGAACCTAATGCTTATATTGCTTTTGCAGGCAAAAGGGTAATTGAACAAACATTGAACAAAATTGTACCGGAAGGTTTACAAACGGCTGAAAATTTATTCCATAAAGGATTATTTGACTTAATTGTACCGCGTAATATTTTAAAAGGGGTTATTTTTGAATTATTTAAACTCCAAGGATTCTTACCCTTGAATATTGATTCAAAGGAATAA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K01963	accD	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Biosynthesis of antibiotics	map01130
		Carbon metabolism	map01200
		Fatty acid metabolism	map01212
		Pyruvate metabolism	map00620
		Propanoate metabolism	map00640
		Carbon fixation pathways in prokaryotes	map00720
		Fatty acid biosynthesis	map00061

GO term	Ontology	Name
GO:0006633	Biological Process	fatty acid biosynthetic process
GO:0003989	Molecular Function	acetyl-CoA carboxylase activity
GO:0009317	Cellular Component	acetyl-CoA carboxylase complex

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.000
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00