Gene detail

Detail information of GWHGAAEX018189/evm.TU.scaffold_90.74

Functional Annotation

Database	Orthologs	E value	Annotation
KOG	KOG3493	4.00E-45	Ubiquitin-like protein
nr	gi\|514805304\|ref\|XP_004977514.1\|	1.14E-45	PREDICTED: ubiquitin-like protein 5-like [Setaria italica]
Swissprot	tr\|Q9FGZ9\|UBL5_ARATH	3.00E-45	Ubiquitin-like protein 5
trEMBL	tr\|K3YAP7\|K3YAP7_SETIT	4.00E-46	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Si011289m}
TAIR	AT3G45180	4.00E-45	Ubiquitin-like superfamily protein

Location And Transcript Sequence

Scaffold	Start	End	Strand
GWHAAEX00000097	2336341	2343744	-

Transcript Sequence
>GWHTAAEX018189 AAGTAAAAAAACATAATTAAATAAAGATTATTGCCTGAAAAGGCGGTGTCCTCCTCCCCAAGTTTCTTTTAAGACTTCTTTCGCTATAAACAAGAAAGGTTCCGTTTATCGGTCAGATTGGTATATCGATTTGATAAAGTTGAAATCAGGGCGGAGAAGATGATCGAGGTGGTGCTGAACGATCGGCTGGGGAAGAAGGTGCGCGTCAAGTGCAACGAGGATGATACCATCGGAGATCTGAAGAAGCTTGTAGCTGCTCAGACTGGAACGCGGCCTGACAAGATCCGCATCCAGAAGTGGTACAACATATATAAGGACCACATCACCCTTCAGGATTACGAGATCCACGACGGCATGGGCCTTGAGCTCTATTACAATTAGAACCGTCCAAAACTACAGTTTTTGCGACATTTGATTTGTGTGGTTTAAAGAACGAAGACTATGACATGTTTAGTATGTATTTTGGAAATTGGATGGAAATGTATGAATTGCAACTTATTTAATGGAGTATAATGGATGCTATGGAATCAATTAATGTTTCTTGCTTTTGAACATAATTTATTTCTTTGTCTTGCTATGGAAATAGTTTTTTGTATATTTTTTAGTTTAGATTCTTGTGTGATGATGCTTAAGAACCAATCTTATTTGGTTGTAGCAAAATTGAGTGATTTTTTCTTTATTTTTGTGATGTTAATTGATTCAGATTTTT

Network for GWHGAAEX018189

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00240.22	ubiquitin	11	70	9.40E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13113	UBL5, HUB1	Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0005515	Molecular Function	protein binding

Expression pattern

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	157.320
SRP064423	SRR2545915	Juvenile tuber	141.970
SRP108465	SRR5643513	five period of Gastrodia elata	301.080
	SRR5643514	five period of Gastrodia elata	395.430
	SRR5643515	five period of Gastrodia elata	366.780
	SRR5643524	five period of Gastrodia elata	395.420
	SRR5643525	five period of Gastrodia elata	505.250
	SRR5643528	five period of Gastrodia elata	581.310
	SRR5643658	five period of Gastrodia elata	453.900
	SRR5643659	five period of Gastrodia elata	239.940
	SRR5643660	five period of Gastrodia elata	228.440
	SRR5643661	five period of Gastrodia elata	235.770
	SRR5643662	five period of Gastrodia elata	266.740
	SRR5643663	five period of Gastrodia elata	268.190
	SRR5643664	five period of Gastrodia elata	273.680
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	155.320
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	169.260
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	176.280
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	135.560
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	154.260
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	143.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	124.410
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	139.880
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	196.830
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	178.690
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	242.970
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	242.970
SRP279888	Gastro	Gastrodia elata tuber	230.40
	Juven	Juvenile tuber	168.24
	Mother_Gastro	Mother tuber of Gastrodia elata	303.31
	Mother_Juven	Mother tuber of Juvenile	180.96