Gene detail

Database	Orthologs	E value	Annotation
COG	gi\|428224245\|ref\|YP_007108342.1\|	3.00E-13	50S ribosomal protein L14 [Geitlerinema sp. PCC 7407]
KOG	KOG0901	5.00E-22	60S ribosomal protein L14/L17/L23
nr	gi\|159161198\|ref\|YP_001542484.1\|	3.82E-23	ribosomal protein L14 [Ceratophyllum demersum]
Swissprot	tr\|A8SEE0\|RK14_CERDE	2.00E-25	50S ribosomal protein L14, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01367}
trEMBL	tr\|C3KEM1\|C3KEM1_CERDE	1.00E-23	50S ribosomal protein L14, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01367, ECO:0000256\|RuleBase:RU003951}
TAIR	ATCH058	5.00E-22	Unannotated protein

Scaffold	Start	End	Strand
GWHAAEX00000089	1378708	1386207	+

Transcript Sequence
>GWHTAAEX018238 ATGCCTTGTATGCCTTTAGAAAGATCAGAAGTAATTAGAGCTGTTATTGTTCGCACATGCAAAGAACTTAAACGAGATAATGGCATGATAATACGATATGATGAGAATGCGGCAGTTTTAATTGATAAAGATGGCAATCCAAAAGTTGGGTTGGGGATGGTTTCACTGAATTTGGCCAAGAGGCACAAGATGGCCCCCAGCGTCTCCAGAGGGCTTGCTTACCTCCACGGTAGCTTCGGAGTGGTGCCTGCCGCACACTATGCCAATGAGATGGCGGCAACTGTAAAGGCGGGGGATAGAAAGCACCCAAGTCCAAAAAGTGTATTTCTGATTTTTAAGGATTGA

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation

Gene family	subfamily
--	--

KO	Enzyme	pathway	mapID
K02874	RP-L14, MRPL14, rplN	Ribosome	map03010

GO term	Ontology	Name
GO:0006412	Biological Process	translation
GO:0003735	Molecular Function	structural constituent of ribosome
GO:0005840	Cellular Component	ribosome

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	0.000
SRP064423	SRR2545915	Juvenile tuber	0.000
SRP108465	SRR5643513	five period of Gastrodia elata	0.000
	SRR5643514	five period of Gastrodia elata	0.000
	SRR5643515	five period of Gastrodia elata	0.000
	SRR5643524	five period of Gastrodia elata	0.000
	SRR5643525	five period of Gastrodia elata	0.000
	SRR5643528	five period of Gastrodia elata	0.000
	SRR5643658	five period of Gastrodia elata	0.000
	SRR5643659	five period of Gastrodia elata	0.000
	SRR5643660	five period of Gastrodia elata	0.000
	SRR5643661	five period of Gastrodia elata	0.000
	SRR5643662	five period of Gastrodia elata	0.000
	SRR5643663	five period of Gastrodia elata	0.000
	SRR5643664	five period of Gastrodia elata	0.000
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	0.000
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	0.000
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	0.000
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	0.000
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	0.000
SRP279888	Gastro	Gastrodia elata tuber	0.00
	Juven	Juvenile tuber	0.00
	Mother_Gastro	Mother tuber of Gastrodia elata	0.00
	Mother_Juven	Mother tuber of Juvenile	0.00