Gene detail

Database	Orthologs	E value	Annotation
nr	gi\|743761072\|ref\|XP_010940400.1\|	9.95E-45	PREDICTED: dehydration-responsive element-binding protein 1F-like [Elaeis guineensis]
Swissprot	tr\|Q8S9Z5\|DRE1F_ORYSJ	6.00E-39	Dehydration-responsive element-binding protein 1F
trEMBL	tr\|K4ATE0\|K4ATE0_SOLLC	8.00E-43	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc01g009440.1.1}
TAIR	AT5G51990	1.00E-31	C-repeat-binding factor 4

Scaffold	Start	End	Strand
GWHAAEX00000098	2185444	2185947	-

Transcript Sequence
>GWHTAAEX018907 ATGACGAACTCCTCCTCCTCCTCCTCCTCGCCCAACGCCATCCCTCCGGGGCGCCGGCCCGGTCACCAAAAACTGAACTTGACCCGTCACCCGCGCTACCGCGGCGTTCGCAAGCGCGAAAGCGAGAAGTGGGTGAGCGAAATGCGCCAGCCAGGCAAGAGGACGCGCATATGGCTCGGAACGTACCCCGCCCCCGAAATGGCGGCGCGGGCGCACGATGCTGCCGCGCTCTTCCTGCGCGGCCCCGACTCCGTCCAGTCGCTGCCCACCGCCCCCTACTCCTGCCCGGAGGATGTTCGTCGGGCGGCGGCCCAGATGGCCTCACAGGAAGGCTCCGACGAGTCCGATCCTCCGACCGAGTTCCTCGATGAGGACGCCATCTTCAACATGCCAGGGATTCTCGTCGATTTGGCCGCCGGGCTCATCATAGCGCCACCGGGATTCTACACGAGTGGCTTCGACTGGGACTCGGCAGAATGGATGCCGCAGCTCTGCCTCTGGTAG

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Module ID	Function Annotation
Module13

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KO	Enzyme	pathway	mapID
--	--	--	--

GO term	Ontology	Name
GO:0006355	Biological Process	regulation of transcription, DNA-templated
GO:0003677	Molecular Function	DNA binding
GO:0003700	Molecular Function	transcription factor activity, sequence-specific DNA binding

SRP	Sample	Description	FPKM
SRP064423	SRR2545914	vegetative propagation corms	15.980
SRP064423	SRR2545915	Juvenile tuber	4.390
SRP108465	SRR5643513	five period of Gastrodia elata	10.450
	SRR5643514	five period of Gastrodia elata	4.160
	SRR5643515	five period of Gastrodia elata	60.780
	SRR5643524	five period of Gastrodia elata	7.050
	SRR5643525	five period of Gastrodia elata	106.830
	SRR5643528	five period of Gastrodia elata	14.970
	SRR5643658	five period of Gastrodia elata	62.060
	SRR5643659	five period of Gastrodia elata	11.210
	SRR5643660	five period of Gastrodia elata	11.950
	SRR5643661	five period of Gastrodia elata	14.510
	SRR5643662	five period of Gastrodia elata	26.610
	SRR5643663	five period of Gastrodia elata	16.550
	SRR5643664	five period of Gastrodia elata	288.550
SRP118053	SRR6049654	Rhizomagastrodiae_C368-T07_good_1	45.140
	SRR6049655	Rhizomagastrodiae_C368-T10_good_1	81.660
	SRR6049656	Rhizomagastrodiae_C368-T07_good_1	21.130
	SRR6049657	Rhizomagastrodiae_C368-T07_good_1	40.710
	SRR6049658	Rhizomagastrodiae_C368-T04_good_1	13.030
	SRR6049659	Rhizomagastrodiae_C368-T04_good_1	11.910
	SRR6049660	Rhizomagastrodiae_C368-T01_good_1	101.890
	SRR6049661	Rhizomagastrodiae_C368-T04_good_1	27.450
	SRR6049662	Rhizomagastrodiae_C368-T01_good_1	19.700
	SRR6049663	Rhizomagastrodiae_C368-T01_good_1	90.130
	SRR6049664	Rhizomagastrodiae_C368-T10_good_1	47.850
	SRR6049665	Rhizomagastrodiae_C368-T10_good_1	47.850
SRP279888	Gastro	Gastrodia elata tuber	14.56
	Juven	Juvenile tuber	3.02
	Mother_Gastro	Mother tuber of Gastrodia elata	10.57
	Mother_Juven	Mother tuber of Juvenile	6.88