Gene detail

Detail information of GWHGAAZE000080

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAC00657.1	3.47624E-72	common plant regulatory factor 6 [Petroselinum crispum]
Swissprot	tr\|P24068\|OCS1_MAIZE	3E-36	Ocs element-binding factor 1
trEMBL	tr\|Q9LEB7\|Q9LEB7_PETCR	1E-72	Common plant regulatory factor 6 {ECO:0000313\|EMBL:CAC00657.1}
TAIR10	AT3G62420.1	7E-41	basic region/leucine zipper motif 53

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	1707780	1708217	-
GWHAAZE00000001	mRNA	1707780	1708217	-
GWHAAZE00000001	exon	1707780	1708217	-
GWHAAZE00000001	CDS	1707780	1708217	-

Transcript Sequence
>GWHTAAZE000080 ATGGCATCAATGCAACAGCAAGTGAGCTCCGGGTCTGATGGTGATCAAAGATATGCAAAATTCGATGAGAGGAAGAGAAAGAGGATGATATCGAACAGGGAATCAGCTAGAAGATCGCGTATGAAAAAGCAGCAACGTGTGGACGATTTGATCAAGCAAATCAGCCAATTGCAAAATGAGAACAAACTCATTGCTCGAAAGATCGATGCAGCCTCGCAAATGTTTGTCGGAGTTGCATCAGATAACAATGTGCTGAGAGCTCAAGTTTCTGAATTGACGGATAGGTTGCATTCGCTGAATAATGTTCTTCATATTGCTGAGGAAGTGAGTGGGTTTGCAATGGACATACCTGAGATTCCTGATAATTTGCTTGAGCCGTGGCAGCTGCCTTGCCCAATATATCAGATCACTGGTGCTTCGGATATGTTCCAGTATTGA

Network for GWHGAAZE000080

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	24	70	9.90E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	65.469
	SRR3591706	second leaf	60.505
	SRR3591707	mature leaf	57.602
	SRR3591708	Shoot apex	62.929
	SRR3591709	Stem	59.611
	SRR3591710	White floral bud	64.536
	SRR3591711	White flower	73.227
	SRR3591712	Green floral bud	62.405
	SRR3591713	Yellow flower	83.213
SRP173429	SRR8316895	Juvenile bud stage	32.373
	SRR8316896	Juvenile bud stage	30.342
	SRR8316897	Juvenile bud stage	20.307
	SRR8316894	Third green stage	18.278
	SRR8316900	Third green stage	48.519
	SRR8316901	Third green stage	38.841
	SRR8316898	Complete white stage	23.353
	SRR8316899	Complete white stage	73.187
	SRR8316903	Complete white stage	39.134
	SRR8316902	Silver flowering stage	32.344
	SRR8316904	Silver flowering stage	26.176
	SRR8316905	Silver flowering stage	10.448
	SRR8316906	Gold flowering stage	37.408
	SRR8316907	Gold flowering stage	33.157
	SRR8316908	Gold flowering stage	36.144
SRP132670	SRR6706286	Control	36.231
	SRR6706287	Light intensity 50%	43.974
	SRR6706288	Light intensity 20%	54.848
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	39.205
	CNS0095593	Slightly white alabastrum(diploid) 2	38.043
	CNS0095594	Slightly white alabastrum(diploid) 3	42.542
	CNS0095595	Whole white alabastrum(diploid) 2	36.900
	CNS0095596	Whole white alabastrum(diploid) 3	23.041
	CNS0095597	Whole white alabastrum(diploid) 4	34.361
	CNS0095598	Silvery flower (diploied) 1	50.242
	CNS0095599	Silvery flower (diploied) 2	27.665
	CNS0095600	Silvery flower (diploied) 3	54.784
	CNS0095601	Golden flower (diploid) 1	41.821
	CNS0095602	Golden flower (diploid) 2	49.363
	CNS0095603	Golden flower (diploid) 3	48.730
	CNS0095604	Slightly white alabastrum(tetraploid) 1	30.474
	CNS0095605	Slightly white alabastrum(tetraploid) 2	28.259
	CNS0095606	Slightly white alabastrum(tetraploid) 3	44.388
	CNS0095607	Whole white alabastrum(tetraploid) 1	25.880
	CNS0095608	Whole white alabastrum(tetraploid) 2	20.100
	CNS0095609	Whole white alabastrum(tetraploid) 3	26.583
	CNS0095610	Silvery flower (tetraploid) 1	34.898
	CNS0095611	Silvery flower (tetraploid) 2	26.054
	CNS0095612	Silvery flower (tetraploid) 3	30.328
	CNS0095613	Golden flower (tetraploid) 1	36.995
	CNS0095614	Golden flower (tetraploid) 2	36.892
	CNS0095615	Golden flower (tetraploid) 3	83.390
CRA001975	CRR073297	Stem 1	48.707
	CRR073298	Stem 2	47.492
	CRR073299	Stem 3	35.458
	CRR073300	Leaf 1	48.898
	CRR073301	Leaf 2	54.320
	CRR073302	Leaf 3	38.384
	CRR073303	Juvenile bud 1	50.361
	CRR073304	Juvenile bud 2	30.944
	CRR073305	Juvenile bud 3	48.419
	CRR073306	Third green 1	44.987
	CRR073307	Third green 2	30.127
	CRR073308	Third green 3	38.116
	CRR073309	Second white 1	23.853
	CRR073310	Second white 2	48.245
	CRR073311	Second white 3	64.626
	CRR073312	Silver flowering 1	115.221
	CRR073313	Silver flowering 2	41.129
	CRR073314	Silver flowering 3	36.379
	CRR073315	Gold flowering 1	227.453
	CRR073316	Gold flowering 2	234.672
	CRR073317	Gold flowering 3	66.869
	CRR073318	Tawny withering 1	101.785
	CRR073319	Tawny withering 2	175.061
	CRR073320	Tawny withering 3	92.754