Gene detail

Detail information of GWHGAAZE000084

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP28248.1	4.00999E-37	hypothetical protein JCGZ_14019 [Jatropha curcas]
COG	YP_003527373.1	0.000005	DNA mismatch repair protein MutS
Swissprot	tr\|O04716\|MSH6_ARATH	7E-29	DNA mismatch repair protein MSH6
trEMBL	tr\|A0A067JZR0\|A0A067JZR0_JATCU	1E-37	DNA mismatch repair protein MSH6 {ECO:0000256\|PIRNR:PIRNR037677}
TAIR10	AT4G02070.2	6E-26	MUTS homolog 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	1835303	1836374	+
GWHAAZE00000001	mRNA	1835303	1836374	+
GWHAAZE00000001	exon	1835303	1835417	+
GWHAAZE00000001	exon	1836127	1836374	+
GWHAAZE00000001	CDS	1835303	1835417	+
GWHAAZE00000001	CDS	1836127	1836374	+

Transcript Sequence
>GWHTAAZE000084 ATGGCATGCCAAGTTGGAAAAGGAGTTAAAGGTCTAGAGGAGGTTACATTTCTTTACAAGTTGACACTCGGTGCATGCCCCAAAAGCTATGGTGTCAATGTTGCAAGGCTAGCTGGACTCCCCGACTTACTGCTTAGGAAAGCTGCTATCAAGTCGCAAGACTTTGAGGGAATGTATGGTAAACATCAGAAGCAGCTCGAAGACAAAACTGTTCAGAGTGATGATGATGATAAGATAACCGTTCTTATTCAAAATTTTATGAAACTTCCAGAAAGTACAAGTTGCCATGAGTCTGCTGAAAGCGTAGTTAGTTCTTTGAATGAACTACAGCAAAGAGCAAGGATCCTTCTAGAGCAAAATTGA

Network for GWHGAAZE000084

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08737	MSH6	Mismatch repair	map03430

Gene Ontology

GO term	Ontology	Name
GO:0006298	biological_process	mismatch repair
GO:0005524	molecular_function	ATP binding
GO:0030983	molecular_function	mismatched DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.175
	SRR3591706	second leaf	4.047
	SRR3591707	mature leaf	5.180
	SRR3591708	Shoot apex	15.118
	SRR3591709	Stem	9.824
	SRR3591710	White floral bud	6.897
	SRR3591711	White flower	9.626
	SRR3591712	Green floral bud	3.593
	SRR3591713	Yellow flower	4.968
SRP173429	SRR8316895	Juvenile bud stage	6.486
	SRR8316896	Juvenile bud stage	7.675
	SRR8316897	Juvenile bud stage	2.923
	SRR8316894	Third green stage	2.394
	SRR8316900	Third green stage	2.509
	SRR8316901	Third green stage	4.658
	SRR8316898	Complete white stage	3.138
	SRR8316899	Complete white stage	4.815
	SRR8316903	Complete white stage	3.102
	SRR8316902	Silver flowering stage	3.239
	SRR8316904	Silver flowering stage	7.158
	SRR8316905	Silver flowering stage	2.001
	SRR8316906	Gold flowering stage	6.368
	SRR8316907	Gold flowering stage	6.619
	SRR8316908	Gold flowering stage	4.886
SRP132670	SRR6706286	Control	1.721
	SRR6706287	Light intensity 50%	1.312
	SRR6706288	Light intensity 20%	1.865
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.615
	CNS0095593	Slightly white alabastrum(diploid) 2	8.244
	CNS0095594	Slightly white alabastrum(diploid) 3	5.241
	CNS0095595	Whole white alabastrum(diploid) 2	4.932
	CNS0095596	Whole white alabastrum(diploid) 3	4.815
	CNS0095597	Whole white alabastrum(diploid) 4	2.543
	CNS0095598	Silvery flower (diploied) 1	6.018
	CNS0095599	Silvery flower (diploied) 2	4.506
	CNS0095600	Silvery flower (diploied) 3	5.703
	CNS0095601	Golden flower (diploid) 1	6.649
	CNS0095602	Golden flower (diploid) 2	2.140
	CNS0095603	Golden flower (diploid) 3	3.084
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.596
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.805
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.548
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.994
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.709
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.704
	CNS0095610	Silvery flower (tetraploid) 1	3.281
	CNS0095611	Silvery flower (tetraploid) 2	6.389
	CNS0095612	Silvery flower (tetraploid) 3	8.627
	CNS0095613	Golden flower (tetraploid) 1	2.092
	CNS0095614	Golden flower (tetraploid) 2	3.769
	CNS0095615	Golden flower (tetraploid) 3	1.205
CRA001975	CRR073297	Stem 1	6.566
	CRR073298	Stem 2	5.179
	CRR073299	Stem 3	6.415
	CRR073300	Leaf 1	3.740
	CRR073301	Leaf 2	4.393
	CRR073302	Leaf 3	2.042
	CRR073303	Juvenile bud 1	4.351
	CRR073304	Juvenile bud 2	1.901
	CRR073305	Juvenile bud 3	2.739
	CRR073306	Third green 1	4.776
	CRR073307	Third green 2	2.610
	CRR073308	Third green 3	3.343
	CRR073309	Second white 1	4.319
	CRR073310	Second white 2	4.537
	CRR073311	Second white 3	3.146
	CRR073312	Silver flowering 1	2.065
	CRR073313	Silver flowering 2	2.519
	CRR073314	Silver flowering 3	2.905
	CRR073315	Gold flowering 1	4.733
	CRR073316	Gold flowering 2	5.247
	CRR073317	Gold flowering 3	1.360
	CRR073318	Tawny withering 1	5.188
	CRR073319	Tawny withering 2	5.688
	CRR073320	Tawny withering 3	4.763