Gene detail

Detail information of GWHGAAZE000162

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011027164.1	6.8354E-131	PREDICTED: dephospho-CoA kinase [Populus euphratica]
COG	NP_470934.1	1E-52	dephospho-CoA kinase
Swissprot	tr\|Q9ZQH0\|COAE_ARATH	4E-114	Dephospho-CoA kinase
trEMBL	tr\|A0A059A867\|A0A059A867_EUCGR	1E-130	Uncharacterized protein {ECO:0000313\|EMBL:KCW50008.1}
TAIR10	AT2G27490.2	2E-83	dephospho-CoA kinase family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	3318447	3320205	-
GWHAAZE00000001	mRNA	3318447	3320205	-
GWHAAZE00000001	exon	3320098	3320205	-
GWHAAZE00000001	exon	3319692	3319837	-
GWHAAZE00000001	exon	3318447	3318879	-
GWHAAZE00000001	CDS	3320098	3320205	-
GWHAAZE00000001	CDS	3319692	3319837	-
GWHAAZE00000001	CDS	3318447	3318879	-

Transcript Sequence
>GWHTAAZE000162 ATGAGATTAGTGGGACTGACCGGAGGGATCGGAACTGGAAAGAGTACGGTCTCCAATCTCTTCAAGGCTCACGGAATACCCGTCGTCGATGCCGATCTCGTCGCTCGTGATGTATTGAAGAAAGGGACTGGTGGATGGAAAAAAGTTGTAGCAGCATTTGGGGATGACATATTACAGGCAAACGGAGAAGTTGATCGGCCGAAGCTCGGTCAAATTGTATTTTCTGATCCTGCAAAGCGGCAGCTTCTCAATAGGCTGCTGGCACCTTATATATCATCAGGTATTTTCTGGGAAGTTTTGAAGCTATGGATCAAGGGTTGTAAGGTTATCGTTCTTGATGTCCCTTTGCTGTTTGAGGCCAAGATAGACAAGTGGACAAAGCCCATTATTGTGGTGTGGGTTGACCTTGCAACGCAGCTTCAGAGACTCATGGCTAGAGACAGAATATCAATCGAAGATGCCAAAAACAGGATCAATGCTCAGATGCCTCTCAATTTGAAGAAGAACAAGGCCGACATAGTGATTGATAACACCGGATCACTCGAAGATTTAAACGAACATTTCAGCAAGGCTTTAGCCCAGGTCTTGAAGCCCTTGACGTGGACTGAATTTTGGCTTTCTAGGCAGGGAGTTGTTGTGGCTCTTGTATCTATTATTTCAGGTATTGTCATATACAACAAAAAGTAG

Network for GWHGAAZE000162

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01121.21	CoaE	3	182	2.80E-59

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00859	coaE	Metabolic pathways	map01100
K00859	coaE	Pantothenate and CoA biosynthesis	map00770

Gene Ontology

GO term	Ontology	Name
GO:0015937	biological_process	coenzyme A biosynthetic process
GO:0004140	molecular_function	dephospho-CoA kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	17.275
	SRR3591706	second leaf	7.226
	SRR3591707	mature leaf	11.166
	SRR3591708	Shoot apex	11.828
	SRR3591709	Stem	13.536
	SRR3591710	White floral bud	15.390
	SRR3591711	White flower	14.381
	SRR3591712	Green floral bud	17.271
	SRR3591713	Yellow flower	15.028
SRP173429	SRR8316895	Juvenile bud stage	11.128
	SRR8316896	Juvenile bud stage	14.323
	SRR8316897	Juvenile bud stage	5.967
	SRR8316894	Third green stage	5.480
	SRR8316900	Third green stage	20.508
	SRR8316901	Third green stage	18.677
	SRR8316898	Complete white stage	7.710
	SRR8316899	Complete white stage	28.091
	SRR8316903	Complete white stage	13.000
	SRR8316902	Silver flowering stage	7.367
	SRR8316904	Silver flowering stage	8.609
	SRR8316905	Silver flowering stage	3.941
	SRR8316906	Gold flowering stage	14.753
	SRR8316907	Gold flowering stage	10.727
	SRR8316908	Gold flowering stage	13.368
SRP132670	SRR6706286	Control	18.227
	SRR6706287	Light intensity 50%	18.389
	SRR6706288	Light intensity 20%	22.326
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	14.113
	CNS0095593	Slightly white alabastrum(diploid) 2	15.878
	CNS0095594	Slightly white alabastrum(diploid) 3	12.052
	CNS0095595	Whole white alabastrum(diploid) 2	12.787
	CNS0095596	Whole white alabastrum(diploid) 3	13.500
	CNS0095597	Whole white alabastrum(diploid) 4	10.284
	CNS0095598	Silvery flower (diploied) 1	14.241
	CNS0095599	Silvery flower (diploied) 2	13.633
	CNS0095600	Silvery flower (diploied) 3	13.796
	CNS0095601	Golden flower (diploid) 1	8.400
	CNS0095602	Golden flower (diploid) 2	13.097
	CNS0095603	Golden flower (diploid) 3	13.846
	CNS0095604	Slightly white alabastrum(tetraploid) 1	15.524
	CNS0095605	Slightly white alabastrum(tetraploid) 2	15.392
	CNS0095606	Slightly white alabastrum(tetraploid) 3	21.618
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.178
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.060
	CNS0095609	Whole white alabastrum(tetraploid) 3	13.836
	CNS0095610	Silvery flower (tetraploid) 1	16.383
	CNS0095611	Silvery flower (tetraploid) 2	18.672
	CNS0095612	Silvery flower (tetraploid) 3	8.919
	CNS0095613	Golden flower (tetraploid) 1	14.485
	CNS0095614	Golden flower (tetraploid) 2	19.048
	CNS0095615	Golden flower (tetraploid) 3	15.700
CRA001975	CRR073297	Stem 1	14.615
	CRR073298	Stem 2	12.043
	CRR073299	Stem 3	13.620
	CRR073300	Leaf 1	17.602
	CRR073301	Leaf 2	18.116
	CRR073302	Leaf 3	17.413
	CRR073303	Juvenile bud 1	18.225
	CRR073304	Juvenile bud 2	15.095
	CRR073305	Juvenile bud 3	13.694
	CRR073306	Third green 1	3.460
	CRR073307	Third green 2	5.191
	CRR073308	Third green 3	4.541
	CRR073309	Second white 1	2.804
	CRR073310	Second white 2	4.444
	CRR073311	Second white 3	3.954
	CRR073312	Silver flowering 1	3.562
	CRR073313	Silver flowering 2	5.022
	CRR073314	Silver flowering 3	1.400
	CRR073315	Gold flowering 1	10.657
	CRR073316	Gold flowering 2	12.499
	CRR073317	Gold flowering 3	8.150
	CRR073318	Tawny withering 1	10.532
	CRR073319	Tawny withering 2	7.598
	CRR073320	Tawny withering 3	14.696