Gene detail

Detail information of GWHGAAZE000387

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG01299.1	3.05072E-85	Photosystem II reaction center PSB28, chloroplastic [Gossypium arboreum]
COG	YP_003885519.1	0.000002	photosystem II reaction center protein Psb28
Swissprot	tr\|Q8W0Y8\|PSB28_ARATH	1E-72	Photosystem II reaction center PSB28 protein, chloroplastic (Precursor)
trEMBL	tr\|D7U379\|D7U379_VITVI	4E-85	Photosystem II reaction center Psb28 protein {ECO:0000256\|RuleBase:RU003509}
TAIR10	AT4G28660.1	4E-58	photosystem II reaction center PSB28 protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	7445241	7445777	+
GWHAAZE00000001	mRNA	7445241	7445777	+
GWHAAZE00000001	exon	7445241	7445777	+
GWHAAZE00000001	CDS	7445241	7445777	+

Transcript Sequence
>GWHTAAZE000389 ATGAAGGAAAATAAAGTTTCAATGACTCAAATCAAGAAAGATAATGACTATTTGTGCTGTGTAGGCATGGCATTTGCAGCTGTTCATCGTAGTGCGCGCTCCCGATTCAACGGCCAACCCTTGCACCTACAACCCTCTTCAAGGACGGCACCACAAAGACGGAATTTCCAAACGTATAGTCTTAGTATACAAATGGTCAAGCCAACGATTCAATTCATACAAGGAACAGATGAGCAAACTATACCGGACGTGAGGCTAACCAAATCAAGAGATGGCACTAATGGTATGGCTATATTTAGGTTTGACCAACCGTCCGTCTTTGACTCATCTGGCGAAGTTGGTGATATAACCGGCTTCTATATGATTGATGAGGAAGGGGTTCTTCAGTCGGTGGATGTTAATGCTAAGTTCGTTAATGGAAAGCCCGCAGGAATTGAAGCAAAGTATATTATGCGAACCCCGCGAGATTGGGACCGGTTCATGAGATTCATGGAGCGGTACGCTAACCAAAATGGCCTGGAGTTCATCAAGAAATGA

Network for GWHGAAZE000387

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03912.15	Psb28	70	175	7.50E-43

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08903	psb28	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015979	biological_process	photosynthesis
GO:0009523	cellular_component	photosystem II
GO:0009654	cellular_component	photosystem II oxygen evolving complex
GO:0016020	cellular_component	membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	96.325
	SRR3591706	second leaf	209.543
	SRR3591707	mature leaf	116.417
	SRR3591708	Shoot apex	137.143
	SRR3591709	Stem	37.431
	SRR3591710	White floral bud	18.687
	SRR3591711	White flower	28.541
	SRR3591712	Green floral bud	33.510
	SRR3591713	Yellow flower	4.987
SRP173429	SRR8316895	Juvenile bud stage	61.485
	SRR8316896	Juvenile bud stage	64.988
	SRR8316897	Juvenile bud stage	48.778
	SRR8316894	Third green stage	31.411
	SRR8316900	Third green stage	112.369
	SRR8316901	Third green stage	107.675
	SRR8316898	Complete white stage	35.920
	SRR8316899	Complete white stage	62.366
	SRR8316903	Complete white stage	54.506
	SRR8316902	Silver flowering stage	33.676
	SRR8316904	Silver flowering stage	37.744
	SRR8316905	Silver flowering stage	21.832
	SRR8316906	Gold flowering stage	43.372
	SRR8316907	Gold flowering stage	41.036
	SRR8316908	Gold flowering stage	43.582
SRP132670	SRR6706286	Control	68.158
	SRR6706287	Light intensity 50%	61.683
	SRR6706288	Light intensity 20%	61.027
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	61.306
	CNS0095593	Slightly white alabastrum(diploid) 2	65.326
	CNS0095594	Slightly white alabastrum(diploid) 3	49.923
	CNS0095595	Whole white alabastrum(diploid) 2	59.799
	CNS0095596	Whole white alabastrum(diploid) 3	73.285
	CNS0095597	Whole white alabastrum(diploid) 4	48.596
	CNS0095598	Silvery flower (diploied) 1	71.693
	CNS0095599	Silvery flower (diploied) 2	75.268
	CNS0095600	Silvery flower (diploied) 3	86.489
	CNS0095601	Golden flower (diploid) 1	53.281
	CNS0095602	Golden flower (diploid) 2	75.020
	CNS0095603	Golden flower (diploid) 3	73.457
	CNS0095604	Slightly white alabastrum(tetraploid) 1	90.931
	CNS0095605	Slightly white alabastrum(tetraploid) 2	88.079
	CNS0095606	Slightly white alabastrum(tetraploid) 3	117.315
	CNS0095607	Whole white alabastrum(tetraploid) 1	42.606
	CNS0095608	Whole white alabastrum(tetraploid) 2	61.369
	CNS0095609	Whole white alabastrum(tetraploid) 3	106.712
	CNS0095610	Silvery flower (tetraploid) 1	119.803
	CNS0095611	Silvery flower (tetraploid) 2	144.131
	CNS0095612	Silvery flower (tetraploid) 3	109.655
	CNS0095613	Golden flower (tetraploid) 1	64.541
	CNS0095614	Golden flower (tetraploid) 2	84.249
	CNS0095615	Golden flower (tetraploid) 3	21.977
CRA001975	CRR073297	Stem 1	118.118
	CRR073298	Stem 2	111.456
	CRR073299	Stem 3	144.280
	CRR073300	Leaf 1	67.184
	CRR073301	Leaf 2	78.524
	CRR073302	Leaf 3	92.955
	CRR073303	Juvenile bud 1	95.842
	CRR073304	Juvenile bud 2	92.800
	CRR073305	Juvenile bud 3	76.576
	CRR073306	Third green 1	54.682
	CRR073307	Third green 2	43.564
	CRR073308	Third green 3	43.182
	CRR073309	Second white 1	123.125
	CRR073310	Second white 2	69.417
	CRR073311	Second white 3	54.275
	CRR073312	Silver flowering 1	36.654
	CRR073313	Silver flowering 2	57.005
	CRR073314	Silver flowering 3	33.311
	CRR073315	Gold flowering 1	334.966
	CRR073316	Gold flowering 2	332.786
	CRR073317	Gold flowering 3	346.779
	CRR073318	Tawny withering 1	52.518
	CRR073319	Tawny withering 2	58.957
	CRR073320	Tawny withering 3	55.323