Gene detail

Detail information of GWHGAAZE000493

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009771719.1	3.43013E-88	PREDICTED: 40S ribosomal protein S8 [Nicotiana sylvestris]
Swissprot	tr\|Q08069\|RS8_MAIZE	8E-85	40S ribosomal protein S8
trEMBL	tr\|V4SRN1\|V4SRN1_9ROSI	1E-87	40S ribosomal protein S8 {ECO:0000256\|RuleBase:RU000669}
TAIR10	AT5G59240.1	2E-47	Ribosomal protein S8e family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	9480616	9481843	+
GWHAAZE00000001	mRNA	9480616	9481843	+
GWHAAZE00000001	exon	9480616	9480686	+
GWHAAZE00000001	exon	9481477	9481843	+
GWHAAZE00000001	CDS	9480616	9480686	+
GWHAAZE00000001	CDS	9481477	9481843	+

Transcript Sequence
>GWHTAAZE000495 ATTTCTAGGGACTCTATGCACAAGAGAAGGGCCACTGGTGGCAAGAAGAAAGCTTGGAGGAAGAAGCGAAAGTATGAGCTTGGTCGCCAGCCCGCTAATACTAAGATCAGTAGTAACAAGACAGTGAGGAGAGTCCGTGTGAGAGGAGGCAATGTGAAGTGGAGAGCTCTCCGTTTGGATACTGGAAATTATTCATGGGGTAGTGAGGCTGTCACTCGCAAGACCCGTATCCTTGACGTGGTCTACAATGCCTCTAACAACGAGCTTGTTCGTACACAAACTCTGGTGAAGGGTGCCATTGTCCAGGTGGATGCAGCACCGTTCAAGCAGTGGTATCTTCAGCACTATGGTGTCGATATTGGAAGGAAGAAAAAGGGTGCTGTTAAGAAGGAAACAACTGAGGTATTCCAGTATAATATGATTTATCTTACTTTTTAA

Network for GWHGAAZE000493

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01201.23	Ribosomal_S8e	1	109	1.20E-42

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02995	RP-S8e, RPS8	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	790.013
	SRR3591706	second leaf	332.559
	SRR3591707	mature leaf	175.555
	SRR3591708	Shoot apex	939.431
	SRR3591709	Stem	384.522
	SRR3591710	White floral bud	381.174
	SRR3591711	White flower	447.592
	SRR3591712	Green floral bud	676.262
	SRR3591713	Yellow flower	341.914
SRP173429	SRR8316895	Juvenile bud stage	452.720
	SRR8316896	Juvenile bud stage	693.424
	SRR8316897	Juvenile bud stage	358.668
	SRR8316894	Third green stage	295.284
	SRR8316900	Third green stage	1012.379
	SRR8316901	Third green stage	971.058
	SRR8316898	Complete white stage	230.605
	SRR8316899	Complete white stage	945.987
	SRR8316903	Complete white stage	330.945
	SRR8316902	Silver flowering stage	193.710
	SRR8316904	Silver flowering stage	180.228
	SRR8316905	Silver flowering stage	104.891
	SRR8316906	Gold flowering stage	425.191
	SRR8316907	Gold flowering stage	431.498
	SRR8316908	Gold flowering stage	537.851
SRP132670	SRR6706286	Control	1565.223
	SRR6706287	Light intensity 50%	1525.569
	SRR6706288	Light intensity 20%	1512.160
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	623.938
	CNS0095593	Slightly white alabastrum(diploid) 2	756.957
	CNS0095594	Slightly white alabastrum(diploid) 3	575.384
	CNS0095595	Whole white alabastrum(diploid) 2	598.967
	CNS0095596	Whole white alabastrum(diploid) 3	723.133
	CNS0095597	Whole white alabastrum(diploid) 4	466.514
	CNS0095598	Silvery flower (diploied) 1	381.557
	CNS0095599	Silvery flower (diploied) 2	357.864
	CNS0095600	Silvery flower (diploied) 3	340.223
	CNS0095601	Golden flower (diploid) 1	295.648
	CNS0095602	Golden flower (diploid) 2	300.294
	CNS0095603	Golden flower (diploid) 3	306.248
	CNS0095604	Slightly white alabastrum(tetraploid) 1	724.475
	CNS0095605	Slightly white alabastrum(tetraploid) 2	678.980
	CNS0095606	Slightly white alabastrum(tetraploid) 3	995.232
	CNS0095607	Whole white alabastrum(tetraploid) 1	407.824
	CNS0095608	Whole white alabastrum(tetraploid) 2	330.041
	CNS0095609	Whole white alabastrum(tetraploid) 3	841.157
	CNS0095610	Silvery flower (tetraploid) 1	464.101
	CNS0095611	Silvery flower (tetraploid) 2	355.810
	CNS0095612	Silvery flower (tetraploid) 3	281.039
	CNS0095613	Golden flower (tetraploid) 1	244.202
	CNS0095614	Golden flower (tetraploid) 2	370.580
	CNS0095615	Golden flower (tetraploid) 3	181.281
CRA001975	CRR073297	Stem 1	1129.117
	CRR073298	Stem 2	1200.625
	CRR073299	Stem 3	1274.350
	CRR073300	Leaf 1	1318.152
	CRR073301	Leaf 2	1398.770
	CRR073302	Leaf 3	1493.765
	CRR073303	Juvenile bud 1	1260.663
	CRR073304	Juvenile bud 2	1109.377
	CRR073305	Juvenile bud 3	941.513
	CRR073306	Third green 1	235.539
	CRR073307	Third green 2	222.806
	CRR073308	Third green 3	242.912
	CRR073309	Second white 1	190.772
	CRR073310	Second white 2	169.185
	CRR073311	Second white 3	128.922
	CRR073312	Silver flowering 1	161.836
	CRR073313	Silver flowering 2	192.223
	CRR073314	Silver flowering 3	179.286
	CRR073315	Gold flowering 1	377.221
	CRR073316	Gold flowering 2	454.326
	CRR073317	Gold flowering 3	309.171
	CRR073318	Tawny withering 1	880.129
	CRR073319	Tawny withering 2	767.283
	CRR073320	Tawny withering 3	944.256