Gene detail

Detail information of GWHGAAZE000507

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010100812.1	4.76379E-60	hypothetical protein L484_015842 [Morus notabilis]
trEMBL	tr\|W9RDQ5\|W9RDQ5_9ROSA	2E-60	Uncharacterized protein {ECO:0000313\|EMBL:EXB84510.1}
TAIR10	AT3G25400.1	2E-44	Without detailed annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	10039036	10043936	+
GWHAAZE00000001	mRNA	10039036	10043936	+
GWHAAZE00000001	exon	10039036	10039163	+
GWHAAZE00000001	exon	10043547	10043936	+
GWHAAZE00000001	five_prime_UTR	10039036	10039088	+
GWHAAZE00000001	CDS	10039089	10039163	+
GWHAAZE00000001	CDS	10043547	10043798	+
GWHAAZE00000001	three_prime_UTR	10043799	10043936	+

Transcript Sequence
>GWHTAAZE000509 TGGCAGGGGTTTCATCAGCAGCAGAAGAAAGTGTGTCCCTTGAACTTCTGAAGATGAAAATGGCAGAGTTCGCAAAGGAAAGAGATTGGGACCGTTTTCATAGCCCCAGAAACCTCCTCTTGGCTATGGTCGGAGAAGTAGGAGAGCTATCGGAGATATTTCAGTGGAAAGGAGAAGTACCAAAGGGATTGCCTGACTGGAAAGAAGAAGAAAAAATACACTTGGGTGAAGAGCTATCTGATGTTCTGCTCTATCTTGTTAGGCTCTCTCACATGTGTGGCATTGATCTTGGCAAAGCTGCTCTTCGCAAAATTCAACTCAATGCCATTAAATACCCAGTCGATAACAACAAAAGCAATGATGATTCTTCTGATATATAATTTATGATGATCTAGAGAGAAAGATAGGGTGGTGTTCTTGTTGTGTTGATGATAATGATGGCCAATTTGCAGGGAGGAACTTTTATTTATACTTTTTTGAAATATGTGCTATAAATGGTTTGCATGAGTACTTCGATC

Network for GWHGAAZE000507

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12643.8	MazG-like	28	103	3.20E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K16904	DCTPP1	Metabolic pathways	map01100
K16904	DCTPP1	Pyrimidine metabolism	map00240

Gene Ontology

GO term	Ontology	Name
GO:0009143	biological_process	nucleoside triphosphate catabolic process
GO:0047429	molecular_function	nucleoside-triphosphate diphosphatase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	44.617
	SRR3591706	second leaf	9.597
	SRR3591707	mature leaf	1.644
	SRR3591708	Shoot apex	49.344
	SRR3591709	Stem	53.189
	SRR3591710	White floral bud	19.914
	SRR3591711	White flower	39.319
	SRR3591712	Green floral bud	31.526
	SRR3591713	Yellow flower	11.977
SRP173429	SRR8316895	Juvenile bud stage	5.065
	SRR8316896	Juvenile bud stage	4.891
	SRR8316897	Juvenile bud stage	3.290
	SRR8316894	Third green stage	2.165
	SRR8316900	Third green stage	19.851
	SRR8316901	Third green stage	24.083
	SRR8316898	Complete white stage	15.815
	SRR8316899	Complete white stage	36.525
	SRR8316903	Complete white stage	34.650
	SRR8316902	Silver flowering stage	9.415
	SRR8316904	Silver flowering stage	11.740
	SRR8316905	Silver flowering stage	6.567
	SRR8316906	Gold flowering stage	6.403
	SRR8316907	Gold flowering stage	21.473
	SRR8316908	Gold flowering stage	19.921
SRP132670	SRR6706286	Control	5.623
	SRR6706287	Light intensity 50%	4.993
	SRR6706288	Light intensity 20%	5.869
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	45.637
	CNS0095593	Slightly white alabastrum(diploid) 2	37.196
	CNS0095594	Slightly white alabastrum(diploid) 3	13.068
	CNS0095595	Whole white alabastrum(diploid) 2	19.681
	CNS0095596	Whole white alabastrum(diploid) 3	26.011
	CNS0095597	Whole white alabastrum(diploid) 4	22.992
	CNS0095598	Silvery flower (diploied) 1	4.807
	CNS0095599	Silvery flower (diploied) 2	5.915
	CNS0095600	Silvery flower (diploied) 3	27.906
	CNS0095601	Golden flower (diploid) 1	3.991
	CNS0095602	Golden flower (diploid) 2	16.694
	CNS0095603	Golden flower (diploid) 3	21.402
	CNS0095604	Slightly white alabastrum(tetraploid) 1	47.390
	CNS0095605	Slightly white alabastrum(tetraploid) 2	37.752
	CNS0095606	Slightly white alabastrum(tetraploid) 3	53.815
	CNS0095607	Whole white alabastrum(tetraploid) 1	49.498
	CNS0095608	Whole white alabastrum(tetraploid) 2	40.828
	CNS0095609	Whole white alabastrum(tetraploid) 3	35.878
	CNS0095610	Silvery flower (tetraploid) 1	119.759
	CNS0095611	Silvery flower (tetraploid) 2	12.119
	CNS0095612	Silvery flower (tetraploid) 3	9.024
	CNS0095613	Golden flower (tetraploid) 1	18.738
	CNS0095614	Golden flower (tetraploid) 2	57.630
	CNS0095615	Golden flower (tetraploid) 3	2.881
CRA001975	CRR073297	Stem 1	2.446
	CRR073298	Stem 2	4.914
	CRR073299	Stem 3	4.632
	CRR073300	Leaf 1	12.108
	CRR073301	Leaf 2	16.607
	CRR073302	Leaf 3	15.368
	CRR073303	Juvenile bud 1	14.215
	CRR073304	Juvenile bud 2	8.901
	CRR073305	Juvenile bud 3	13.301
	CRR073306	Third green 1	6.759
	CRR073307	Third green 2	14.287
	CRR073308	Third green 3	5.237
	CRR073309	Second white 1	1.685
	CRR073310	Second white 2	0.964
	CRR073311	Second white 3	4.464
	CRR073312	Silver flowering 1	0.979
	CRR073313	Silver flowering 2	1.469
	CRR073314	Silver flowering 3	1.455
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.186
	CRR073317	Gold flowering 3	0.449
	CRR073318	Tawny withering 1	8.335
	CRR073319	Tawny withering 2	7.561
	CRR073320	Tawny withering 3	10.168