Gene detail

Detail information of GWHGAAZE000569

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP04042.1	7.96049E-39	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9FPR6\|ARR17_ARATH	5E-35	Two-component response regulator ARR17
trEMBL	tr\|A0A068U6V2\|A0A068U6V2_COFCA	3E-39	Coffea canephora DH200=94 genomic scaffold, scaffold_11 {ECO:0000313\|EMBL:CDP04042.1}
TAIR10	AT3G56380.1	4E-28	response regulator 17

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	11425701	11427456	-
GWHAAZE00000001	mRNA	11425701	11427456	-
GWHAAZE00000001	exon	11427435	11427456	-
GWHAAZE00000001	exon	11426435	11426511	-
GWHAAZE00000001	exon	11425939	11426016	-
GWHAAZE00000001	exon	11425701	11425775	-
GWHAAZE00000001	CDS	11427435	11427456	-
GWHAAZE00000001	CDS	11426435	11426511	-
GWHAAZE00000001	CDS	11425939	11426016	-
GWHAAZE00000001	CDS	11425701	11425775	-

Transcript Sequence
>GWHTAAZE000571 ATGGCTTCATCTTCCTCAATGGTGACAACTGCGGAAAATGGGCAGAGGGCTTTGGAGTTTTTGGGGCTGGGTGATGGACACCACACCATCAACAACATCGGCTCCAAGATAAACTTGATAATTACTGATTACTGTATGCCAGGAATGACAGGTTATGAGCTCCTTAAAAAAATCAAGGAATCATCGTACCTAAGAGAGATACCTGTAGTTATCGTGTCATCTGAGAATGTCCCGACTCGAATCAAGAAGTAA

Network for GWHGAAZE000569

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00072.25	Response_reg	7	78	7.20E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Others

KEGG pathway

KO	Enzyme	pathway	mapID
K14492	ARR-A	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0000160	biological_process	phosphorelay signal transduction system

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.029
	SRR3591706	second leaf	1.851
	SRR3591707	mature leaf	0.082
	SRR3591708	Shoot apex	4.390
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.315
	SRR3591711	White flower	0.291
	SRR3591712	Green floral bud	0.028
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.145
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.237
	SRR8316900	Third green stage	0.624
	SRR8316901	Third green stage	0.198
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.024
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.113
	SRR6706288	Light intensity 20%	0.350
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.486
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.093
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.149
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.662
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.362
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.356
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.345
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.653
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.390
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.335
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.163
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.438
	CRR073298	Stem 2	0.465
	CRR073299	Stem 3	0.024
	CRR073300	Leaf 1	0.764
	CRR073301	Leaf 2	2.682
	CRR073302	Leaf 3	0.100
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000