Gene detail

Detail information of GWHGAAZE000648

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010264614.1	1.1955E-73	PREDICTED: U-box domain-containing protein 44-like [Nelumbo nucifera]
Swissprot	tr\|Q9LM76\|PUB44_ARATH	1E-20	U-box domain-containing protein 44
trEMBL	tr\|W9RJL8\|W9RJL8_9ROSA	1E-73	U-box domain-containing protein 43 {ECO:0000313\|EMBL:EXB94113.1}
TAIR10	AT1G20780.1	8E-19	senescence-associated E3 ubiquitin ligase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	13263791	13264249	+
GWHAAZE00000001	mRNA	13263791	13264249	+
GWHAAZE00000001	exon	13263791	13264249	+
GWHAAZE00000001	CDS	13263791	13264249	+

Transcript Sequence
>GWHTAAZE000650 ATGAAGGATCCTGTGGTGTTGGAATCATCACAAAACTATGAGAAAAATGCAATTCAGTACTGGTTCGAGCGGTGTATAGAGGATGGTCGGAACCCAACTTGTCCAGTCACTGGACAGGTTCTCAATTCTCTTGAGCTTAAGCCGAACATTGGACTGGCTGGTGCAATAGAGGAGTGGCTCAATAGAAATATTGAGATTCATGTAAAATCGGCTGTGAAGGATTTAAGTGAGGATCCTCCTTCGGTGGATTGCATTGAGAGGGTGTTGGATAATATTCATAAAATTTCAGAAGAGCATCCAGGTTGTAGATACAAAATTAGGAATGCTGGCCTTGTTGTTCTTGTTGTTAATATGCTTAGGAACGGCTCAAAGAGTATAGGATCACATTTGAGAAGCAAAGCTCTTATGACTTTACTTAGCATGGCCAAGGATGGAGAAAGTAAGGTGTGTTCAATCTAG

Network for GWHGAAZE000648

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0171

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04564.16	U-box	1	63	7.10E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0016567	biological_process	protein ubiquitination
GO:0004842	molecular_function	ubiquitin-protein transferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.519
	SRR3591706	second leaf	4.532
	SRR3591707	mature leaf	3.380
	SRR3591708	Shoot apex	4.483
	SRR3591709	Stem	8.355
	SRR3591710	White floral bud	2.929
	SRR3591711	White flower	4.927
	SRR3591712	Green floral bud	2.284
	SRR3591713	Yellow flower	3.564
SRP173429	SRR8316895	Juvenile bud stage	7.048
	SRR8316896	Juvenile bud stage	5.510
	SRR8316897	Juvenile bud stage	8.706
	SRR8316894	Third green stage	1.079
	SRR8316900	Third green stage	2.481
	SRR8316901	Third green stage	2.660
	SRR8316898	Complete white stage	0.908
	SRR8316899	Complete white stage	3.616
	SRR8316903	Complete white stage	2.083
	SRR8316902	Silver flowering stage	1.084
	SRR8316904	Silver flowering stage	2.785
	SRR8316905	Silver flowering stage	1.462
	SRR8316906	Gold flowering stage	5.029
	SRR8316907	Gold flowering stage	1.969
	SRR8316908	Gold flowering stage	4.169
SRP132670	SRR6706286	Control	1.949
	SRR6706287	Light intensity 50%	1.737
	SRR6706288	Light intensity 20%	1.840
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.722
	CNS0095593	Slightly white alabastrum(diploid) 2	1.028
	CNS0095594	Slightly white alabastrum(diploid) 3	2.076
	CNS0095595	Whole white alabastrum(diploid) 2	0.961
	CNS0095596	Whole white alabastrum(diploid) 3	0.599
	CNS0095597	Whole white alabastrum(diploid) 4	0.887
	CNS0095598	Silvery flower (diploied) 1	3.487
	CNS0095599	Silvery flower (diploied) 2	4.999
	CNS0095600	Silvery flower (diploied) 3	7.613
	CNS0095601	Golden flower (diploid) 1	5.705
	CNS0095602	Golden flower (diploid) 2	9.683
	CNS0095603	Golden flower (diploid) 3	9.586
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.143
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.294
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.464
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.910
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.350
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.215
	CNS0095610	Silvery flower (tetraploid) 1	6.847
	CNS0095611	Silvery flower (tetraploid) 2	5.694
	CNS0095612	Silvery flower (tetraploid) 3	3.607
	CNS0095613	Golden flower (tetraploid) 1	1.807
	CNS0095614	Golden flower (tetraploid) 2	5.186
	CNS0095615	Golden flower (tetraploid) 3	2.155
CRA001975	CRR073297	Stem 1	1.523
	CRR073298	Stem 2	1.816
	CRR073299	Stem 3	2.366
	CRR073300	Leaf 1	2.401
	CRR073301	Leaf 2	2.537
	CRR073302	Leaf 3	1.792
	CRR073303	Juvenile bud 1	0.811
	CRR073304	Juvenile bud 2	1.142
	CRR073305	Juvenile bud 3	2.784
	CRR073306	Third green 1	0.638
	CRR073307	Third green 2	0.305
	CRR073308	Third green 3	0.678
	CRR073309	Second white 1	1.238
	CRR073310	Second white 2	0.489
	CRR073311	Second white 3	0.149
	CRR073312	Silver flowering 1	0.817
	CRR073313	Silver flowering 2	0.828
	CRR073314	Silver flowering 3	0.700
	CRR073315	Gold flowering 1	1.979
	CRR073316	Gold flowering 2	5.509
	CRR073317	Gold flowering 3	2.504
	CRR073318	Tawny withering 1	3.349
	CRR073319	Tawny withering 2	1.400
	CRR073320	Tawny withering 3	3.551