Gene detail

Detail information of GWHGAAZE000662

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010264614.1	1.1955E-73	PREDICTED: U-box domain-containing protein 44-like [Nelumbo nucifera]
Swissprot	tr\|Q9LM76\|PUB44_ARATH	1E-20	U-box domain-containing protein 44
trEMBL	tr\|W9RJL8\|W9RJL8_9ROSA	1E-73	U-box domain-containing protein 43 {ECO:0000313\|EMBL:EXB94113.1}
TAIR10	AT1G20780.1	8E-19	senescence-associated E3 ubiquitin ligase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	13526368	13526826	+
GWHAAZE00000001	mRNA	13526368	13526826	+
GWHAAZE00000001	exon	13526368	13526826	+
GWHAAZE00000001	CDS	13526368	13526826	+

Transcript Sequence
>GWHTAAZE000664 ATGAAGGATCCTGTGGTGTTGGAATCATCACAAAACTATGAGAAAAATGCAATTCAGTACTGGTTCGAGCGGTGTATAGAGGATGGTCGGAACCCAACTTGTCCAGTCACTGGACAGGTTCTCAATTCTCTTGAGCTTAAGCCGAACATTGGACTGGCTGGTGCAATAGAGGAGTGGCTCAATAGAAATATTGAGATTCATGTAAAATCGGCTGTGAAGGATTTAAGTGAGGATCCTCCTTCGGTGGATTGCATTGAGAGGGTGTTGGATAATATTCATAAAATTTCAGAAGAGCATCCAGGTTGTAGATACAAAATTAGGAATGCTGGCCTTGTTGTTCTTGTTGTTAATATGCTTAGGAACGGCTCAAAGAGTATAGGATCACATTTGAGAAGCAAAGCTCTTATGACTTTACTTAGCATGGCCAAGGATGGAGAAAGTAAGGTGTGTTCAATCTAG

Network for GWHGAAZE000662

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0171

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04564.16	U-box	1	63	7.10E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0016567	biological_process	protein ubiquitination
GO:0004842	molecular_function	ubiquitin-protein transferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.979
	SRR3591706	second leaf	5.140
	SRR3591707	mature leaf	4.514
	SRR3591708	Shoot apex	5.327
	SRR3591709	Stem	12.107
	SRR3591710	White floral bud	3.930
	SRR3591711	White flower	4.967
	SRR3591712	Green floral bud	2.648
	SRR3591713	Yellow flower	3.794
SRP173429	SRR8316895	Juvenile bud stage	9.845
	SRR8316896	Juvenile bud stage	9.260
	SRR8316897	Juvenile bud stage	14.215
	SRR8316894	Third green stage	1.141
	SRR8316900	Third green stage	4.813
	SRR8316901	Third green stage	4.420
	SRR8316898	Complete white stage	2.139
	SRR8316899	Complete white stage	6.666
	SRR8316903	Complete white stage	3.077
	SRR8316902	Silver flowering stage	1.887
	SRR8316904	Silver flowering stage	4.386
	SRR8316905	Silver flowering stage	1.642
	SRR8316906	Gold flowering stage	7.932
	SRR8316907	Gold flowering stage	3.804
	SRR8316908	Gold flowering stage	8.203
SRP132670	SRR6706286	Control	2.873
	SRR6706287	Light intensity 50%	3.379
	SRR6706288	Light intensity 20%	2.958
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.134
	CNS0095593	Slightly white alabastrum(diploid) 2	1.821
	CNS0095594	Slightly white alabastrum(diploid) 3	3.574
	CNS0095595	Whole white alabastrum(diploid) 2	1.853
	CNS0095596	Whole white alabastrum(diploid) 3	0.594
	CNS0095597	Whole white alabastrum(diploid) 4	1.048
	CNS0095598	Silvery flower (diploied) 1	4.314
	CNS0095599	Silvery flower (diploied) 2	7.588
	CNS0095600	Silvery flower (diploied) 3	9.552
	CNS0095601	Golden flower (diploid) 1	10.204
	CNS0095602	Golden flower (diploid) 2	17.754
	CNS0095603	Golden flower (diploid) 3	16.393
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.137
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.833
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.614
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.887
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.540
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.287
	CNS0095610	Silvery flower (tetraploid) 1	8.586
	CNS0095611	Silvery flower (tetraploid) 2	8.061
	CNS0095612	Silvery flower (tetraploid) 3	5.326
	CNS0095613	Golden flower (tetraploid) 1	3.174
	CNS0095614	Golden flower (tetraploid) 2	6.819
	CNS0095615	Golden flower (tetraploid) 3	3.798
CRA001975	CRR073297	Stem 1	2.447
	CRR073298	Stem 2	2.583
	CRR073299	Stem 3	3.075
	CRR073300	Leaf 1	3.612
	CRR073301	Leaf 2	3.268
	CRR073302	Leaf 3	2.886
	CRR073303	Juvenile bud 1	1.183
	CRR073304	Juvenile bud 2	1.347
	CRR073305	Juvenile bud 3	3.335
	CRR073306	Third green 1	0.909
	CRR073307	Third green 2	0.628
	CRR073308	Third green 3	1.217
	CRR073309	Second white 1	1.725
	CRR073310	Second white 2	0.982
	CRR073311	Second white 3	0.532
	CRR073312	Silver flowering 1	1.122
	CRR073313	Silver flowering 2	1.237
	CRR073314	Silver flowering 3	1.054
	CRR073315	Gold flowering 1	3.694
	CRR073316	Gold flowering 2	9.450
	CRR073317	Gold flowering 3	5.795
	CRR073318	Tawny withering 1	5.286
	CRR073319	Tawny withering 2	2.502
	CRR073320	Tawny withering 3	4.193