Gene detail

Detail information of GWHGAAZE000705

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011089409.1	9.8229E-175	PREDICTED: proliferating cell nuclear antigen [Sesamum indicum]
Swissprot	tr\|O82797\|PCNA_TOBAC	8E-177	Proliferating cell nuclear antigen
trEMBL	tr\|M1CZM1\|M1CZM1_SOLTU	6E-175	Proliferating cell nuclear antigen {ECO:0000256\|RuleBase:RU000641}
TAIR10	AT2G29570.1	2E-131	proliferating cell nuclear antigen 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	14358944	14361558	+
GWHAAZE00000001	mRNA	14358944	14361558	+
GWHAAZE00000001	exon	14358944	14359217	+
GWHAAZE00000001	exon	14360537	14360689	+
GWHAAZE00000001	exon	14360809	14360906	+
GWHAAZE00000001	exon	14361334	14361558	+
GWHAAZE00000001	CDS	14358944	14359217	+
GWHAAZE00000001	CDS	14360537	14360689	+
GWHAAZE00000001	CDS	14360809	14360906	+
GWHAAZE00000001	CDS	14361334	14361558	+

Transcript Sequence
>GWHTAAZE000707 ATGTTGGAACTCAGGCTCGTACAAGGCAGTCTGCTGAAGAAGGTTATGGAATCGATTAAGGATTTGGTGAACGATGCGAACTTCGATTGTTCGGCCACTGGATTCTCTTTACAGGCCATGGATTCGAGCCACGTGGCACTGGTGTCTCTGCTTCTCAGATCCGAGGGTTTCGAGCACTACCGGTGCGATCGAAATATATCGATGGGGATGAATTTGAGTAATATGTCGAAGATGTTGAAGTGTGCTGGTAATGATGATATTATCACTATTAAGGCACAAGACAAGATTGCTGATTTCGAAATGAAACTTATGGACATCGATAGTGAGCACCTTGGAATCCCAGAAGCAGAGTACCATGCAATTGTTAGGATGCCCTCGGCAGAGTTTGCACGAATTTGTAAAGATCTCAGTAGTATTGGAGACACAGTTGTGATCTCTGTGACCAAAGAGGGTGTGAAGTTTTCAACAAGAGGTGATATCGGCACTGCAAACATTGTCTGCCGGCAGAATACCACTGTAGACAAGCCAGAAGAAGCCACAATAATAGAGATGAATGAGCCAGTGTCATTGACATTTGCACTGAGATACATGAACTCCTTCACCAAAGCAACTCCGCTATCGAATACGGTCACAATTAGCTTGTCTTCAGAACTTCCTGTTGTGGTGGAGTACAAGATAGCTGAGATGGGTTACATCAGATACTATTTAGCCCCCAAGATTGAAGAAGACGACGAAGAGACTAAACCATGA

Network for GWHGAAZE000705

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00705.19	PCNA_N	1	100	1.80E-46
PF02747.16	PCNA_C	112	239	1.10E-61

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04802	PCNA	DNA replication	map03030
		Base excision repair	map03410
		Nucleotide excision repair	map03420
		Mismatch repair	map03430
		Cell cycle	map04110
		Tight junction	map04530

Gene Ontology

GO term	Ontology	Name
GO:0006275	biological_process	regulation of DNA replication
GO:0003677	molecular_function	DNA binding
GO:0030337	molecular_function	DNA polymerase processivity factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	45.788
	SRR3591706	second leaf	16.279
	SRR3591707	mature leaf	7.985
	SRR3591708	Shoot apex	133.688
	SRR3591709	Stem	26.645
	SRR3591710	White floral bud	21.233
	SRR3591711	White flower	34.523
	SRR3591712	Green floral bud	21.638
	SRR3591713	Yellow flower	27.371
SRP173429	SRR8316895	Juvenile bud stage	25.077
	SRR8316896	Juvenile bud stage	23.606
	SRR8316897	Juvenile bud stage	9.230
	SRR8316894	Third green stage	7.382
	SRR8316900	Third green stage	18.300
	SRR8316901	Third green stage	15.498
	SRR8316898	Complete white stage	7.360
	SRR8316899	Complete white stage	20.243
	SRR8316903	Complete white stage	15.540
	SRR8316902	Silver flowering stage	9.666
	SRR8316904	Silver flowering stage	16.259
	SRR8316905	Silver flowering stage	5.092
	SRR8316906	Gold flowering stage	13.480
	SRR8316907	Gold flowering stage	15.793
	SRR8316908	Gold flowering stage	14.798
SRP132670	SRR6706286	Control	19.844
	SRR6706287	Light intensity 50%	23.961
	SRR6706288	Light intensity 20%	25.183
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	25.483
	CNS0095593	Slightly white alabastrum(diploid) 2	23.386
	CNS0095594	Slightly white alabastrum(diploid) 3	20.048
	CNS0095595	Whole white alabastrum(diploid) 2	14.580
	CNS0095596	Whole white alabastrum(diploid) 3	9.912
	CNS0095597	Whole white alabastrum(diploid) 4	9.767
	CNS0095598	Silvery flower (diploied) 1	20.349
	CNS0095599	Silvery flower (diploied) 2	23.149
	CNS0095600	Silvery flower (diploied) 3	20.309
	CNS0095601	Golden flower (diploid) 1	14.690
	CNS0095602	Golden flower (diploid) 2	14.850
	CNS0095603	Golden flower (diploid) 3	14.280
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.554
	CNS0095605	Slightly white alabastrum(tetraploid) 2	20.485
	CNS0095606	Slightly white alabastrum(tetraploid) 3	30.300
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.442
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.774
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.482
	CNS0095610	Silvery flower (tetraploid) 1	17.719
	CNS0095611	Silvery flower (tetraploid) 2	15.835
	CNS0095612	Silvery flower (tetraploid) 3	20.946
	CNS0095613	Golden flower (tetraploid) 1	22.216
	CNS0095614	Golden flower (tetraploid) 2	15.397
	CNS0095615	Golden flower (tetraploid) 3	15.465
CRA001975	CRR073297	Stem 1	44.620
	CRR073298	Stem 2	36.977
	CRR073299	Stem 3	64.263
	CRR073300	Leaf 1	19.599
	CRR073301	Leaf 2	21.703
	CRR073302	Leaf 3	16.222
	CRR073303	Juvenile bud 1	24.234
	CRR073304	Juvenile bud 2	14.965
	CRR073305	Juvenile bud 3	23.685
	CRR073306	Third green 1	20.209
	CRR073307	Third green 2	20.297
	CRR073308	Third green 3	21.409
	CRR073309	Second white 1	33.167
	CRR073310	Second white 2	24.878
	CRR073311	Second white 3	20.100
	CRR073312	Silver flowering 1	18.033
	CRR073313	Silver flowering 2	30.469
	CRR073314	Silver flowering 3	16.642
	CRR073315	Gold flowering 1	27.480
	CRR073316	Gold flowering 2	26.571
	CRR073317	Gold flowering 3	22.665
	CRR073318	Tawny withering 1	50.353
	CRR073319	Tawny withering 2	48.173
	CRR073320	Tawny withering 3	64.410