Gene detail

Detail information of GWHGAAZE000716

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011089805.1	2.9213E-123	PREDICTED: DNA-directed RNA polymerase II subunit RPB7 [Sesamum indicum]
Swissprot	tr\|P46279\|RPB7_SOYBN	8E-120	DNA-directed RNA polymerase II subunit RPB7
trEMBL	tr\|A0A022R5Q4\|A0A022R5Q4_ERYGU	8E-123	Uncharacterized protein {ECO:0000313\|EMBL:EYU34943.1}
TAIR10	AT5G59180.1	7E-92	DNA-directed RNA polymerase II

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	14542654	14545912	+
GWHAAZE00000001	mRNA	14542654	14545912	+
GWHAAZE00000001	exon	14542654	14542769	+
GWHAAZE00000001	exon	14542851	14543016	+
GWHAAZE00000001	exon	14543099	14543149	+
GWHAAZE00000001	exon	14545152	14545217	+
GWHAAZE00000001	exon	14545311	14545379	+
GWHAAZE00000001	exon	14545847	14545912	+
GWHAAZE00000001	CDS	14542654	14542769	+
GWHAAZE00000001	CDS	14542851	14543016	+
GWHAAZE00000001	CDS	14543099	14543149	+
GWHAAZE00000001	CDS	14545152	14545217	+
GWHAAZE00000001	CDS	14545311	14545379	+
GWHAAZE00000001	CDS	14545847	14545912	+

Transcript Sequence
>GWHTAAZE000718 ATGTTCTTCCACATAGTACTGGAGAGAAATATGCAGCTACACCCTCGCCATTTCGGTCGGGACCTTCGAGAAAAGCTCGTCGCAAAATTAATGAAGGACGTGGAGGGGACTTGCAGTGGTCGACACGGCTTCGTAGTTGCTATTACTGGTATCGAAAGCGTTGGTAAAGGCCTAATTAGAGATGGAACTGGTTTCGTTACCTTTCCGGTGAAGTATCAATGCGTTGTTTTTCGGCCTTTCAAGGGAGAGATTTTGGAAGCTGTTGTAACAATGGTTAACAAGATGGGGTTTTTTGCTGAAGCTGGGCCAGTTCAGATTTTTGTTTCAAATCATCTGATCCCGGATGATATGGAATTCCAAACTGGAGATATGCCTAATTACACAACATCGGATGGATCTGTGAAGATTCAGAAGGAGAGCGAAGTTCGGCTAAAGATCATTGGCACTCGAGTAGATGCCACTGAAATTTTCTGTATCGGTACCATAAAAGACGATTTCTTGGGCGTAATCAGTGATCCAGGTGCGACTTCTTGA

Network for GWHGAAZE000716

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03876.18	SHS2_Rpb7-N	8	64	1.20E-12
PF00575.24	S1	78	156	2.20E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03015	RPB7, POLR2G	RNA polymerase	map03020

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	53.331
	SRR3591706	second leaf	45.667
	SRR3591707	mature leaf	51.685
	SRR3591708	Shoot apex	72.037
	SRR3591709	Stem	54.047
	SRR3591710	White floral bud	63.055
	SRR3591711	White flower	71.526
	SRR3591712	Green floral bud	65.479
	SRR3591713	Yellow flower	82.534
SRP173429	SRR8316895	Juvenile bud stage	52.139
	SRR8316896	Juvenile bud stage	62.831
	SRR8316897	Juvenile bud stage	28.590
	SRR8316894	Third green stage	26.636
	SRR8316900	Third green stage	80.969
	SRR8316901	Third green stage	80.700
	SRR8316898	Complete white stage	39.844
	SRR8316899	Complete white stage	122.071
	SRR8316903	Complete white stage	57.379
	SRR8316902	Silver flowering stage	40.501
	SRR8316904	Silver flowering stage	49.641
	SRR8316905	Silver flowering stage	26.703
	SRR8316906	Gold flowering stage	88.457
	SRR8316907	Gold flowering stage	81.322
	SRR8316908	Gold flowering stage	91.432
SRP132670	SRR6706286	Control	72.891
	SRR6706287	Light intensity 50%	82.970
	SRR6706288	Light intensity 20%	92.810
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	50.907
	CNS0095593	Slightly white alabastrum(diploid) 2	62.555
	CNS0095594	Slightly white alabastrum(diploid) 3	53.100
	CNS0095595	Whole white alabastrum(diploid) 2	52.796
	CNS0095596	Whole white alabastrum(diploid) 3	49.494
	CNS0095597	Whole white alabastrum(diploid) 4	46.632
	CNS0095598	Silvery flower (diploied) 1	71.842
	CNS0095599	Silvery flower (diploied) 2	62.887
	CNS0095600	Silvery flower (diploied) 3	64.195
	CNS0095601	Golden flower (diploid) 1	65.582
	CNS0095602	Golden flower (diploid) 2	60.083
	CNS0095603	Golden flower (diploid) 3	57.192
	CNS0095604	Slightly white alabastrum(tetraploid) 1	66.519
	CNS0095605	Slightly white alabastrum(tetraploid) 2	51.299
	CNS0095606	Slightly white alabastrum(tetraploid) 3	102.536
	CNS0095607	Whole white alabastrum(tetraploid) 1	37.651
	CNS0095608	Whole white alabastrum(tetraploid) 2	38.544
	CNS0095609	Whole white alabastrum(tetraploid) 3	73.855
	CNS0095610	Silvery flower (tetraploid) 1	92.637
	CNS0095611	Silvery flower (tetraploid) 2	75.665
	CNS0095612	Silvery flower (tetraploid) 3	78.499
	CNS0095613	Golden flower (tetraploid) 1	60.978
	CNS0095614	Golden flower (tetraploid) 2	78.191
	CNS0095615	Golden flower (tetraploid) 3	48.071
CRA001975	CRR073297	Stem 1	49.417
	CRR073298	Stem 2	43.737
	CRR073299	Stem 3	47.150
	CRR073300	Leaf 1	43.938
	CRR073301	Leaf 2	44.473
	CRR073302	Leaf 3	46.188
	CRR073303	Juvenile bud 1	43.270
	CRR073304	Juvenile bud 2	34.790
	CRR073305	Juvenile bud 3	36.315
	CRR073306	Third green 1	12.433
	CRR073307	Third green 2	19.497
	CRR073308	Third green 3	17.743
	CRR073309	Second white 1	26.172
	CRR073310	Second white 2	30.385
	CRR073311	Second white 3	25.350
	CRR073312	Silver flowering 1	20.684
	CRR073313	Silver flowering 2	21.442
	CRR073314	Silver flowering 3	27.004
	CRR073315	Gold flowering 1	32.671
	CRR073316	Gold flowering 2	50.075
	CRR073317	Gold flowering 3	32.319
	CRR073318	Tawny withering 1	42.330
	CRR073319	Tawny withering 2	43.317
	CRR073320	Tawny withering 3	52.865