Gene detail

Detail information of GWHGAAZE000908

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006424575.1	1.284E-111	hypothetical protein CICLE_v10029416mg [Citrus clementina]
Swissprot	tr\|O50003\|RL12_PRUAR	4E-110	60S ribosomal protein L12
trEMBL	tr\|A0A067GD54\|A0A067GD54_CITSI	5E-112	Uncharacterized protein {ECO:0000313\|EMBL:KDO73276.1}
TAIR10	AT5G60670.1	4E-83	Ribosomal protein L11 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	19291206	19291706	-
GWHAAZE00000001	mRNA	19291206	19291706	-
GWHAAZE00000001	exon	19291206	19291706	-
GWHAAZE00000001	CDS	19291206	19291706	-

Transcript Sequence
>GWHTAAZE000910 ATGCCCCCAAAGTTCGATCCATCGCAAGTCGTCGATGTATACGTCCGAGTAACCGGCGGCGAAGTCGGAGCAGCCAGTTCCCTCGCTCCGAAGATCGGACCACTCGGTCTCTCACCGAAGAAGATCGGTGAAGACATCGCCAAAGAGACTGCTAAGGACTGGAAAGGTCTCCGAGTTACCGTTAAACTTACGGTCCAGAATCGTCAGGCGAAGGTCGCCGTGGTTCCGTCGGCAGCGGCGCTTGTCATCAAGGCCTTGAAAGAGCCGGAGCGAGATCGGAAGAAGACGAAGAACATTAAGCACACTGGAAACATTTCTCTTGATGATGTGATTGAGATTGCAAAGATTATGAGGCCAAGATCTATGGCGAAGGAGTTGAGTGGGACGGTGAAGGAGATTCTAGGGACTTGTGTGAGTGTTGGATGTACTGTTGATGGTAAGGATCCGAAGGATCTGCAGCAGGAGATTGCCGATGGTGATGTTGAGATTCCTCTGGACTGA

Network for GWHGAAZE000908

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03946.15	Ribosomal_L11_N	10	70	3.40E-20
PF00298.20	Ribosomal_L11	75	144	3.80E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02870	RP-L12e, RPL12	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	190.582
	SRR3591706	second leaf	71.844
	SRR3591707	mature leaf	45.164
	SRR3591708	Shoot apex	195.513
	SRR3591709	Stem	107.213
	SRR3591710	White floral bud	93.690
	SRR3591711	White flower	159.501
	SRR3591712	Green floral bud	209.354
	SRR3591713	Yellow flower	105.747
SRP173429	SRR8316895	Juvenile bud stage	105.399
	SRR8316896	Juvenile bud stage	154.170
	SRR8316897	Juvenile bud stage	90.589
	SRR8316894	Third green stage	65.616
	SRR8316900	Third green stage	254.122
	SRR8316901	Third green stage	208.615
	SRR8316898	Complete white stage	46.552
	SRR8316899	Complete white stage	171.237
	SRR8316903	Complete white stage	59.716
	SRR8316902	Silver flowering stage	64.103
	SRR8316904	Silver flowering stage	56.706
	SRR8316905	Silver flowering stage	32.279
	SRR8316906	Gold flowering stage	87.381
	SRR8316907	Gold flowering stage	101.547
	SRR8316908	Gold flowering stage	119.997
SRP132670	SRR6706286	Control	310.840
	SRR6706287	Light intensity 50%	307.472
	SRR6706288	Light intensity 20%	334.054
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	175.491
	CNS0095593	Slightly white alabastrum(diploid) 2	205.691
	CNS0095594	Slightly white alabastrum(diploid) 3	163.894
	CNS0095595	Whole white alabastrum(diploid) 2	144.119
	CNS0095596	Whole white alabastrum(diploid) 3	169.744
	CNS0095597	Whole white alabastrum(diploid) 4	115.070
	CNS0095598	Silvery flower (diploied) 1	102.577
	CNS0095599	Silvery flower (diploied) 2	84.513
	CNS0095600	Silvery flower (diploied) 3	88.361
	CNS0095601	Golden flower (diploid) 1	52.007
	CNS0095602	Golden flower (diploid) 2	70.058
	CNS0095603	Golden flower (diploid) 3	65.215
	CNS0095604	Slightly white alabastrum(tetraploid) 1	161.605
	CNS0095605	Slightly white alabastrum(tetraploid) 2	173.660
	CNS0095606	Slightly white alabastrum(tetraploid) 3	218.886
	CNS0095607	Whole white alabastrum(tetraploid) 1	89.571
	CNS0095608	Whole white alabastrum(tetraploid) 2	84.658
	CNS0095609	Whole white alabastrum(tetraploid) 3	167.236
	CNS0095610	Silvery flower (tetraploid) 1	111.498
	CNS0095611	Silvery flower (tetraploid) 2	79.968
	CNS0095612	Silvery flower (tetraploid) 3	67.678
	CNS0095613	Golden flower (tetraploid) 1	56.615
	CNS0095614	Golden flower (tetraploid) 2	74.608
	CNS0095615	Golden flower (tetraploid) 3	39.472
CRA001975	CRR073297	Stem 1	229.289
	CRR073298	Stem 2	234.536
	CRR073299	Stem 3	293.584
	CRR073300	Leaf 1	235.118
	CRR073301	Leaf 2	250.689
	CRR073302	Leaf 3	405.797
	CRR073303	Juvenile bud 1	384.907
	CRR073304	Juvenile bud 2	269.728
	CRR073305	Juvenile bud 3	260.178
	CRR073306	Third green 1	88.636
	CRR073307	Third green 2	91.927
	CRR073308	Third green 3	88.539
	CRR073309	Second white 1	129.951
	CRR073310	Second white 2	102.265
	CRR073311	Second white 3	56.079
	CRR073312	Silver flowering 1	66.118
	CRR073313	Silver flowering 2	94.563
	CRR073314	Silver flowering 3	66.657
	CRR073315	Gold flowering 1	121.990
	CRR073316	Gold flowering 2	134.504
	CRR073317	Gold flowering 3	137.254
	CRR073318	Tawny withering 1	325.154
	CRR073319	Tawny withering 2	233.686
	CRR073320	Tawny withering 3	330.821