Gene detail

Detail information of GWHGAAZE000976

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	NP_001241270.1	1.02016E-12	uncharacterized protein LOC100780989 [Glycine max]
Swissprot	tr\|Q9FFB3\|VP241_ARATH	0.000000002	Vacuolar protein sorting-associated protein 24 homolog 1
trEMBL	tr\|C6TD23\|C6TD23_SOYBN	4E-13	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA12G08510.1}
TAIR10	AT3G45000.1	0.00000006	SNF7 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	20829328	20830697	+
GWHAAZE00000001	mRNA	20829328	20830697	+
GWHAAZE00000001	exon	20829328	20829335	+
GWHAAZE00000001	exon	20829445	20829565	+
GWHAAZE00000001	exon	20830590	20830697	+
GWHAAZE00000001	CDS	20829328	20829335	+
GWHAAZE00000001	CDS	20829445	20829565	+
GWHAAZE00000001	CDS	20830590	20830697	+

Transcript Sequence
>GWHTAAZE000978 ATGCTAAGCTATTGCCCATACTGTTGGGGATATGTCCAAGAGTGCCAAAGTCATGAAGCTTGTAAAGACCTCATCAAGGCTCTTGAAATGGCCGTCACAATGCAAGAATTCCGTAAGGAAATGACCAAGGCTGGCATGATCGAAGAGATTGTGAATGATGCGGTTGTCACAGTGCTGGATTCAGAGATATTGAAGATGAGATTGATGAAGAAGTTGACAAGGTCTTCATCGCGATAG

Network for GWHGAAZE000976

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12193	VPS24, CHMP3	Endocytosis	map04144
K12193	VPS24, CHMP3	Necroptosis	map04217

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.893
	SRR3591706	second leaf	0.125
	SRR3591707	mature leaf	0.337
	SRR3591708	Shoot apex	0.322
	SRR3591709	Stem	2.415
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.387
	SRR3591712	Green floral bud	0.442
	SRR3591713	Yellow flower	0.100
SRP173429	SRR8316895	Juvenile bud stage	0.621
	SRR8316896	Juvenile bud stage	1.226
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	1.298
	SRR8316900	Third green stage	1.116
	SRR8316901	Third green stage	0.889
	SRR8316898	Complete white stage	1.624
	SRR8316899	Complete white stage	2.452
	SRR8316903	Complete white stage	2.125
	SRR8316902	Silver flowering stage	1.387
	SRR8316904	Silver flowering stage	2.029
	SRR8316905	Silver flowering stage	1.642
	SRR8316906	Gold flowering stage	4.803
	SRR8316907	Gold flowering stage	4.942
	SRR8316908	Gold flowering stage	2.348
SRP132670	SRR6706286	Control	1.995
	SRR6706287	Light intensity 50%	2.834
	SRR6706288	Light intensity 20%	2.256
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.028
	CNS0095593	Slightly white alabastrum(diploid) 2	1.730
	CNS0095594	Slightly white alabastrum(diploid) 3	0.828
	CNS0095595	Whole white alabastrum(diploid) 2	2.552
	CNS0095596	Whole white alabastrum(diploid) 3	3.578
	CNS0095597	Whole white alabastrum(diploid) 4	2.226
	CNS0095598	Silvery flower (diploied) 1	1.547
	CNS0095599	Silvery flower (diploied) 2	2.704
	CNS0095600	Silvery flower (diploied) 3	2.601
	CNS0095601	Golden flower (diploid) 1	7.413
	CNS0095602	Golden flower (diploid) 2	5.075
	CNS0095603	Golden flower (diploid) 3	4.016
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.507
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.155
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.567
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.597
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.352
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.813
	CNS0095610	Silvery flower (tetraploid) 1	2.642
	CNS0095611	Silvery flower (tetraploid) 2	4.027
	CNS0095612	Silvery flower (tetraploid) 3	7.948
	CNS0095613	Golden flower (tetraploid) 1	3.549
	CNS0095614	Golden flower (tetraploid) 2	3.526
	CNS0095615	Golden flower (tetraploid) 3	5.797
CRA001975	CRR073297	Stem 1	2.846
	CRR073298	Stem 2	2.027
	CRR073299	Stem 3	0.962
	CRR073300	Leaf 1	2.504
	CRR073301	Leaf 2	2.420
	CRR073302	Leaf 3	1.586
	CRR073303	Juvenile bud 1	2.462
	CRR073304	Juvenile bud 2	1.141
	CRR073305	Juvenile bud 3	0.160
	CRR073306	Third green 1	7.407
	CRR073307	Third green 2	4.171
	CRR073308	Third green 3	5.709
	CRR073309	Second white 1	2.320
	CRR073310	Second white 2	4.425
	CRR073311	Second white 3	1.251
	CRR073312	Silver flowering 1	1.375
	CRR073313	Silver flowering 2	0.442
	CRR073314	Silver flowering 3	0.103
	CRR073315	Gold flowering 1	0.796
	CRR073316	Gold flowering 2	1.115
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	3.589
	CRR073319	Tawny withering 2	3.630
	CRR073320	Tawny withering 3	0.158