Gene detail

Detail information of GWHGAAZE001002

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAN64374.1	1.4179E-111	hypothetical protein VITISV_018664 [Vitis vinifera]
trEMBL	tr\|A5C9W6\|A5C9W6_VITVI	5E-112	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN64374.1}
TAIR10	AT5G22860.1	2E-66	Serine carboxypeptidase S28 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	21587174	21590213	+
GWHAAZE00000001	mRNA	21587174	21590213	+
GWHAAZE00000001	exon	21587174	21587310	+
GWHAAZE00000001	exon	21587903	21588146	+
GWHAAZE00000001	exon	21588746	21588901	+
GWHAAZE00000001	exon	21589418	21589497	+
GWHAAZE00000001	exon	21590150	21590213	+
GWHAAZE00000001	CDS	21587174	21587310	+
GWHAAZE00000001	CDS	21587903	21588146	+
GWHAAZE00000001	CDS	21588746	21588901	+
GWHAAZE00000001	CDS	21589418	21589497	+
GWHAAZE00000001	CDS	21590150	21590213	+

Transcript Sequence
>GWHTAAZE001004 ATGGCTAATTTTAATAATTTGCAGGAAGCTAGTGAAAGCTGTTACGAAACAATAAGAAAATCATGGTCGAAAATAGATGAAATTGCATCTAAACCCAATGGGCTTTCAATCCTCACCAAGAGATTCAAGATTTGCAAGCCATTGAAGAAATCTTTAAAGTTAAAGGACTACTTAGATACAATGTACGCAACTGCAGCTCAATACAATAAGCCCCCAAATTATCCAGTGAGTGAGGTGTGTAAGGGAATTGATGGAGCCCCAAAAGGGAGTGATATTATTGACAAGATATTTAATGGTATGGTTGCTTATAAAGGGAATAGATCTTGCTATGATACTAGAAGTATATTTCCAACACAAACAACCGTTGGGTGGGCATGGCAAACATGTAGCGAAATGGTGATACCCATTGGGCGTGGTAGCAATGACACTATGTTCCAATCGGCTCCTTTCAACTTAAAAGACTTTATCGAGCACTGCACCAAGCAATACGGGGTCCCACCTCGGCCTCATTGGGTCACAACTTACTATGGCGGCCATGATATAAAATTGGTTCTTAATAAGTTTGCTAGCAACATCATTTTCTCTAATGGCCTGAGAGATCCTTATAGCAGCGGCGGGGTGTTGGAGGACATTTCAGATAGTGTCCTTGCCATCTCTACTGTTAAAGGTATCCCTTCTTAA

Network for GWHGAAZE001002

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05577.13	Peptidase_S28	6	218	1.60E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01285	PRCP	Renin-angiotensin system	map04614
K01285	PRCP	Protein digestion and absorption	map04974

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0008236	molecular_function	serine-type peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.329
	SRR3591706	second leaf	37.066
	SRR3591707	mature leaf	23.840
	SRR3591708	Shoot apex	9.810
	SRR3591709	Stem	38.179
	SRR3591710	White floral bud	9.669
	SRR3591711	White flower	5.562
	SRR3591712	Green floral bud	9.296
	SRR3591713	Yellow flower	3.799
SRP173429	SRR8316895	Juvenile bud stage	7.553
	SRR8316896	Juvenile bud stage	15.531
	SRR8316897	Juvenile bud stage	3.067
	SRR8316894	Third green stage	4.767
	SRR8316900	Third green stage	7.887
	SRR8316901	Third green stage	9.599
	SRR8316898	Complete white stage	2.006
	SRR8316899	Complete white stage	10.166
	SRR8316903	Complete white stage	3.046
	SRR8316902	Silver flowering stage	2.331
	SRR8316904	Silver flowering stage	11.411
	SRR8316905	Silver flowering stage	4.425
	SRR8316906	Gold flowering stage	6.102
	SRR8316907	Gold flowering stage	4.450
	SRR8316908	Gold flowering stage	4.947
SRP132670	SRR6706286	Control	7.388
	SRR6706287	Light intensity 50%	5.639
	SRR6706288	Light intensity 20%	7.518
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	14.299
	CNS0095593	Slightly white alabastrum(diploid) 2	18.314
	CNS0095594	Slightly white alabastrum(diploid) 3	16.904
	CNS0095595	Whole white alabastrum(diploid) 2	7.523
	CNS0095596	Whole white alabastrum(diploid) 3	8.116
	CNS0095597	Whole white alabastrum(diploid) 4	5.799
	CNS0095598	Silvery flower (diploied) 1	5.332
	CNS0095599	Silvery flower (diploied) 2	5.301
	CNS0095600	Silvery flower (diploied) 3	3.167
	CNS0095601	Golden flower (diploid) 1	4.097
	CNS0095602	Golden flower (diploid) 2	4.648
	CNS0095603	Golden flower (diploid) 3	6.167
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.848
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.765
	CNS0095606	Slightly white alabastrum(tetraploid) 3	21.215
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.334
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.008
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.956
	CNS0095610	Silvery flower (tetraploid) 1	10.616
	CNS0095611	Silvery flower (tetraploid) 2	6.498
	CNS0095612	Silvery flower (tetraploid) 3	5.296
	CNS0095613	Golden flower (tetraploid) 1	1.956
	CNS0095614	Golden flower (tetraploid) 2	13.108
	CNS0095615	Golden flower (tetraploid) 3	3.651
CRA001975	CRR073297	Stem 1	10.514
	CRR073298	Stem 2	12.783
	CRR073299	Stem 3	13.342
	CRR073300	Leaf 1	6.912
	CRR073301	Leaf 2	8.575
	CRR073302	Leaf 3	8.636
	CRR073303	Juvenile bud 1	10.803
	CRR073304	Juvenile bud 2	4.135
	CRR073305	Juvenile bud 3	7.440
	CRR073306	Third green 1	7.138
	CRR073307	Third green 2	25.483
	CRR073308	Third green 3	18.903
	CRR073309	Second white 1	0.783
	CRR073310	Second white 2	3.694
	CRR073311	Second white 3	0.614
	CRR073312	Silver flowering 1	0.230
	CRR073313	Silver flowering 2	4.396
	CRR073314	Silver flowering 3	1.463
	CRR073315	Gold flowering 1	14.329
	CRR073316	Gold flowering 2	10.649
	CRR073317	Gold flowering 3	9.416
	CRR073318	Tawny withering 1	33.502
	CRR073319	Tawny withering 2	45.495
	CRR073320	Tawny withering 3	17.452