Gene detail

Detail information of GWHGAAZE001238

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009760350.1	3.32484E-71	PREDICTED: mitochondrial fission 1 protein A-like [Nicotiana sylvestris]
Swissprot	tr\|Q9M1J1\|FIS1A_ARATH	2E-59	Mitochondrial fission 1 protein A
trEMBL	tr\|M1D380\|M1D380_SOLTU	5E-70	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400080258}
TAIR10	AT3G57090.1	2E-47	Tetratricopeptide repeat (TPR)-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	28950453	28954484	-
GWHAAZE00000001	mRNA	28950453	28954484	-
GWHAAZE00000001	exon	28954392	28954484	-
GWHAAZE00000001	exon	28950781	28950919	-
GWHAAZE00000001	exon	28950453	28950580	-
GWHAAZE00000001	CDS	28954392	28954484	-
GWHAAZE00000001	CDS	28950781	28950919	-
GWHAAZE00000001	CDS	28950453	28950580	-

Transcript Sequence
>GWHTAAZE001240 ATGGAAGCGAAGATTACCGGTTTCTTCGATTCAGTCGGTACCTTCTTCACCGGCGGTGATCAGATTCCATGGTGCGACTCCGATATCGTTGTTGGCTGTGAACGTGAGGTTGCAGAGGCTGAGAAAGGTTCCTCTGATGAACTTAAAAGTGAATGCATTATGCGGTTGTCATGGGCTCTTGTTCACTCAAAACGACCAGAAGATGTACAACGTGGAATAGCAATGCTTGAAGCTTCTTTGGCTAATCCTGGAAGCCCTCTGCAATTGAGAGAGAAGATTTATCTCTTGGCTATTGGGCATTACAGAAGTGGGGACTATTCAAGGAGCAGGCAACTTGTTGAACGCTGTTTGGAGGTATGA

Network for GWHGAAZE001238

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF14852.7	Fis1_TPR_N	51	80	2.10E-11
PF14853.7	Fis1_TPR_C	90	119	4.60E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K17969	FIS1, TTC11, MDV2	Mitophagy - animal	map04137
K17969	FIS1, TTC11, MDV2	Mitophagy - yeast	map04139

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	82.358
	SRR3591706	second leaf	39.748
	SRR3591707	mature leaf	38.018
	SRR3591708	Shoot apex	37.054
	SRR3591709	Stem	99.309
	SRR3591710	White floral bud	67.173
	SRR3591711	White flower	79.434
	SRR3591712	Green floral bud	62.994
	SRR3591713	Yellow flower	79.736
SRP173429	SRR8316895	Juvenile bud stage	30.648
	SRR8316896	Juvenile bud stage	42.830
	SRR8316897	Juvenile bud stage	34.578
	SRR8316894	Third green stage	15.998
	SRR8316900	Third green stage	57.544
	SRR8316901	Third green stage	51.067
	SRR8316898	Complete white stage	28.070
	SRR8316899	Complete white stage	64.238
	SRR8316903	Complete white stage	40.735
	SRR8316902	Silver flowering stage	31.824
	SRR8316904	Silver flowering stage	38.806
	SRR8316905	Silver flowering stage	21.483
	SRR8316906	Gold flowering stage	88.789
	SRR8316907	Gold flowering stage	77.849
	SRR8316908	Gold flowering stage	117.106
SRP132670	SRR6706286	Control	81.646
	SRR6706287	Light intensity 50%	75.207
	SRR6706288	Light intensity 20%	79.841
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	34.485
	CNS0095593	Slightly white alabastrum(diploid) 2	48.319
	CNS0095594	Slightly white alabastrum(diploid) 3	34.375
	CNS0095595	Whole white alabastrum(diploid) 2	34.714
	CNS0095596	Whole white alabastrum(diploid) 3	27.479
	CNS0095597	Whole white alabastrum(diploid) 4	33.407
	CNS0095598	Silvery flower (diploied) 1	39.816
	CNS0095599	Silvery flower (diploied) 2	43.762
	CNS0095600	Silvery flower (diploied) 3	67.765
	CNS0095601	Golden flower (diploid) 1	37.732
	CNS0095602	Golden flower (diploid) 2	56.116
	CNS0095603	Golden flower (diploid) 3	49.899
	CNS0095604	Slightly white alabastrum(tetraploid) 1	41.142
	CNS0095605	Slightly white alabastrum(tetraploid) 2	40.258
	CNS0095606	Slightly white alabastrum(tetraploid) 3	62.747
	CNS0095607	Whole white alabastrum(tetraploid) 1	35.841
	CNS0095608	Whole white alabastrum(tetraploid) 2	42.825
	CNS0095609	Whole white alabastrum(tetraploid) 3	46.310
	CNS0095610	Silvery flower (tetraploid) 1	89.081
	CNS0095611	Silvery flower (tetraploid) 2	103.946
	CNS0095612	Silvery flower (tetraploid) 3	68.189
	CNS0095613	Golden flower (tetraploid) 1	84.506
	CNS0095614	Golden flower (tetraploid) 2	98.559
	CNS0095615	Golden flower (tetraploid) 3	102.914
CRA001975	CRR073297	Stem 1	57.155
	CRR073298	Stem 2	46.024
	CRR073299	Stem 3	84.363
	CRR073300	Leaf 1	58.305
	CRR073301	Leaf 2	72.248
	CRR073302	Leaf 3	77.044
	CRR073303	Juvenile bud 1	98.823
	CRR073304	Juvenile bud 2	73.525
	CRR073305	Juvenile bud 3	92.758
	CRR073306	Third green 1	67.028
	CRR073307	Third green 2	58.925
	CRR073308	Third green 3	57.592
	CRR073309	Second white 1	80.379
	CRR073310	Second white 2	50.777
	CRR073311	Second white 3	41.794
	CRR073312	Silver flowering 1	50.781
	CRR073313	Silver flowering 2	52.255
	CRR073314	Silver flowering 3	33.353
	CRR073315	Gold flowering 1	45.576
	CRR073316	Gold flowering 2	43.175
	CRR073317	Gold flowering 3	33.610
	CRR073318	Tawny withering 1	77.910
	CRR073319	Tawny withering 2	87.516
	CRR073320	Tawny withering 3	90.850