Gene detail

Detail information of GWHGAAZE001270

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007222398.1	7.63597E-89	hypothetical protein PRUPE_ppa008114mg [Prunus persica]
Swissprot	tr\|O80543\|Y1280_ARATH	4E-82	Putative methyltransferase At1g22800
trEMBL	tr\|M5XBV8\|M5XBV8_PRUPE	3E-89	Uncharacterized protein {ECO:0000313\|EMBL:EMJ23597.1}
TAIR10	AT1G22800.1	5E-67	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	29718751	29721407	+
GWHAAZE00000001	mRNA	29718751	29721407	+
GWHAAZE00000001	exon	29718751	29718905	+
GWHAAZE00000001	exon	29719072	29719141	+
GWHAAZE00000001	exon	29720136	29720200	+
GWHAAZE00000001	exon	29720302	29720380	+
GWHAAZE00000001	exon	29721294	29721407	+
GWHAAZE00000001	CDS	29718751	29718905	+
GWHAAZE00000001	CDS	29719072	29719141	+
GWHAAZE00000001	CDS	29720136	29720200	+
GWHAAZE00000001	CDS	29720302	29720380	+
GWHAAZE00000001	CDS	29721294	29721407	+

Transcript Sequence
>GWHTAAZE001274 ATGGGCATTTCAGGTGCCATTGAGAAGCTAATTATGATGGATATGTCACATGACATGGTGAAAAGGTGTAAAGATGCTGAGAAATTTATACCTAATGATAATATTGAAACATCATATATGATTGCTGATGAAGAGTTTTTGCCCGTAAAAGAGAGCTCTCTAGATCTGGTGATCGGTTGCCTGGGCCTCCATTGGACAAACGATCTTCCTGGAGCCATGATACAGTCTAGATTGGCACTGAAACCTGATGGCCTATTTTTGGCAGCTATTCTTGGAGGAGAGACGTTAAAGGAGCTGAGAATAGCTTGCACTGTTGCACAAATGGAACGTGAAGGCGGCATTAGTCCACGTATATCACCTTTGGCACAAGTGCGAGATGCAGGCAACCTTTTGACTAGGGCAGGGTTCAGCCTTCCTGGTGTTGATGTTGATGAATTCACTGTTAGATACAAAAATGGTGACCAATTTCCTCCTGATCTTTGA

Network for GWHGAAZE001270

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08241.13	Methyltransf_11	9	87	2.40E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K18162	NDUFAF5	Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0008168	molecular_function	methyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.849
	SRR3591706	second leaf	0.331
	SRR3591707	mature leaf	0.537
	SRR3591708	Shoot apex	2.505
	SRR3591709	Stem	0.789
	SRR3591710	White floral bud	1.205
	SRR3591711	White flower	0.642
	SRR3591712	Green floral bud	0.932
	SRR3591713	Yellow flower	0.224
SRP173429	SRR8316895	Juvenile bud stage	4.527
	SRR8316896	Juvenile bud stage	6.682
	SRR8316897	Juvenile bud stage	5.458
	SRR8316894	Third green stage	2.082
	SRR8316900	Third green stage	5.952
	SRR8316901	Third green stage	7.379
	SRR8316898	Complete white stage	1.737
	SRR8316899	Complete white stage	6.818
	SRR8316903	Complete white stage	2.181
	SRR8316902	Silver flowering stage	1.933
	SRR8316904	Silver flowering stage	2.265
	SRR8316905	Silver flowering stage	0.628
	SRR8316906	Gold flowering stage	4.210
	SRR8316907	Gold flowering stage	4.313
	SRR8316908	Gold flowering stage	8.651
SRP132670	SRR6706286	Control	6.073
	SRR6706287	Light intensity 50%	5.071
	SRR6706288	Light intensity 20%	4.174
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.784
	CNS0095593	Slightly white alabastrum(diploid) 2	5.011
	CNS0095594	Slightly white alabastrum(diploid) 3	3.398
	CNS0095595	Whole white alabastrum(diploid) 2	1.958
	CNS0095596	Whole white alabastrum(diploid) 3	3.222
	CNS0095597	Whole white alabastrum(diploid) 4	3.427
	CNS0095598	Silvery flower (diploied) 1	3.032
	CNS0095599	Silvery flower (diploied) 2	3.471
	CNS0095600	Silvery flower (diploied) 3	3.145
	CNS0095601	Golden flower (diploid) 1	3.576
	CNS0095602	Golden flower (diploid) 2	2.657
	CNS0095603	Golden flower (diploid) 3	3.079
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.354
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.657
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.356
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.523
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.951
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.144
	CNS0095610	Silvery flower (tetraploid) 1	2.739
	CNS0095611	Silvery flower (tetraploid) 2	1.786
	CNS0095612	Silvery flower (tetraploid) 3	2.092
	CNS0095613	Golden flower (tetraploid) 1	2.130
	CNS0095614	Golden flower (tetraploid) 2	2.474
	CNS0095615	Golden flower (tetraploid) 3	1.454
CRA001975	CRR073297	Stem 1	4.222
	CRR073298	Stem 2	3.878
	CRR073299	Stem 3	3.535
	CRR073300	Leaf 1	5.561
	CRR073301	Leaf 2	4.386
	CRR073302	Leaf 3	6.252
	CRR073303	Juvenile bud 1	6.937
	CRR073304	Juvenile bud 2	3.326
	CRR073305	Juvenile bud 3	3.097
	CRR073306	Third green 1	1.107
	CRR073307	Third green 2	0.888
	CRR073308	Third green 3	1.340
	CRR073309	Second white 1	1.233
	CRR073310	Second white 2	0.515
	CRR073311	Second white 3	2.181
	CRR073312	Silver flowering 1	0.239
	CRR073313	Silver flowering 2	0.580
	CRR073314	Silver flowering 3	0.282
	CRR073315	Gold flowering 1	2.620
	CRR073316	Gold flowering 2	2.649
	CRR073317	Gold flowering 3	1.743
	CRR073318	Tawny withering 1	2.074
	CRR073319	Tawny withering 2	2.006
	CRR073320	Tawny withering 3	3.829