Gene detail

Detail information of GWHGAAZE001296

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006470728.1	4.889E-132	PREDICTED: phytochromobilin:ferredoxin oxidoreductase, chloroplastic-like isoform X1 [Citrus sinensis]
Swissprot	tr\|Q9SR43\|PFBS_ARATH	1E-111	Phytochromobilin:ferredoxin oxidoreductase, chloroplastic (Precursor)
trEMBL	tr\|F6HA07\|F6HA07_VITVI	3E-131	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB49027.1}
TAIR10	AT3G09150.1	1E-90	phytochromobilin:ferredoxin oxidoreductase, chloroplast / phytochromobilin synthase (HY2)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	30429055	30435672	+
GWHAAZE00000001	mRNA	30429055	30435672	+
GWHAAZE00000001	exon	30429055	30429119	+
GWHAAZE00000001	exon	30429488	30429631	+
GWHAAZE00000001	exon	30431122	30431215	+
GWHAAZE00000001	exon	30431505	30431636	+
GWHAAZE00000001	exon	30433665	30433769	+
GWHAAZE00000001	exon	30435079	30435129	+
GWHAAZE00000001	exon	30435487	30435672	+
GWHAAZE00000001	CDS	30429055	30429119	+
GWHAAZE00000001	CDS	30429488	30429631	+
GWHAAZE00000001	CDS	30431122	30431215	+
GWHAAZE00000001	CDS	30431505	30431636	+
GWHAAZE00000001	CDS	30433665	30433769	+
GWHAAZE00000001	CDS	30435079	30435129	+
GWHAAZE00000001	CDS	30435487	30435672	+

Transcript Sequence
>GWHTAAZE001300 ATGGGAAGAGATGCTTGTCTAATTAGAAGATATAGCCAGATGGGATTTTGGCTTAGCCTTATTGGGACGTACAACTTTCTTCGTCCTGATTCTGTTTTAAAAATATGCATGCAGGTGTTGGACTTTGCTGTATTCCCGGAACCAGAATACGACCTGCCTATTTTTTGTGCCAACTTTTTCACCACTGTTAACATGAACATAATTGTATTGGACCTTAATCCTCTGCATGACGTCATTAATCAAAAAGTGTACAAGGAGAAGTACTATAAAAGTATTATCCCTATTGGCCTCAAATATGCTGAGCTTTTACCTTGGGGAGGACAGCTAACTAGTGAGTCCTTGAGGTTTTTCTCACCAATAGTTATATGGACCAAGTTTTCTTCAAGCCAGAACAAGCATAGTGTTTTATACTCTGCATTCGTGGATTACTACAAGGCATGGCTTGAGCTTATGGACCAGGCAACGGAGGAGACGGACACTGCCCAAATTAGCTGCAATTGTGAAGCACAGCATAGGTATCTAACGTGGAGAGCAGAAAAGGATCCAGGTCACGGCCTGCTCAAGAAGTTAGTTGGGGAAACTATTGCAAAGGAAGTGGTGAATGAGTTTCTTTTCAGTGGAATTAATGAGCTTGGAAGCAAAACATTTCTTGACTATTTTCCGGAGTACAGGTGTGAGGATGGGACCGTGAACACAAAGCGCAGTATCATCGGAAAATCATTTGAAGAACGGCCGTGGGATACAAGAGGAGAATTCATAGGTAATAGTTTTAGATAG

Network for GWHGAAZE001296

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05996.13	Fe_bilin_red	37	205	8.90E-49

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08101	HY2	Biosynthesis of secondary metabolites	map01110
K08101	HY2	Porphyrin and chlorophyll metabolism	map00860

Gene Ontology

GO term	Ontology	Name
GO:0010024	biological_process	phytochromobilin biosynthetic process
GO:0055114	biological_process	oxidation-reduction process
GO:0016636	molecular_function	oxidoreductase activity, acting on the CH-CH group of donors, iron-sulfur protein as acceptor
GO:0050897	molecular_function	cobalt ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.101
	SRR3591706	second leaf	7.406
	SRR3591707	mature leaf	8.646
	SRR3591708	Shoot apex	7.806
	SRR3591709	Stem	3.569
	SRR3591710	White floral bud	5.538
	SRR3591711	White flower	10.719
	SRR3591712	Green floral bud	8.202
	SRR3591713	Yellow flower	7.650
SRP173429	SRR8316895	Juvenile bud stage	7.618
	SRR8316896	Juvenile bud stage	10.857
	SRR8316897	Juvenile bud stage	6.543
	SRR8316894	Third green stage	4.221
	SRR8316900	Third green stage	12.925
	SRR8316901	Third green stage	13.443
	SRR8316898	Complete white stage	3.432
	SRR8316899	Complete white stage	10.558
	SRR8316903	Complete white stage	5.113
	SRR8316902	Silver flowering stage	5.506
	SRR8316904	Silver flowering stage	5.915
	SRR8316905	Silver flowering stage	3.759
	SRR8316906	Gold flowering stage	6.995
	SRR8316907	Gold flowering stage	5.766
	SRR8316908	Gold flowering stage	7.125
SRP132670	SRR6706286	Control	14.077
	SRR6706287	Light intensity 50%	10.974
	SRR6706288	Light intensity 20%	11.659
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.488
	CNS0095593	Slightly white alabastrum(diploid) 2	7.854
	CNS0095594	Slightly white alabastrum(diploid) 3	8.716
	CNS0095595	Whole white alabastrum(diploid) 2	8.147
	CNS0095596	Whole white alabastrum(diploid) 3	13.559
	CNS0095597	Whole white alabastrum(diploid) 4	8.582
	CNS0095598	Silvery flower (diploied) 1	13.587
	CNS0095599	Silvery flower (diploied) 2	13.173
	CNS0095600	Silvery flower (diploied) 3	24.769
	CNS0095601	Golden flower (diploid) 1	8.434
	CNS0095602	Golden flower (diploid) 2	14.842
	CNS0095603	Golden flower (diploid) 3	13.480
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.763
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.409
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.977
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.901
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.977
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.556
	CNS0095610	Silvery flower (tetraploid) 1	29.923
	CNS0095611	Silvery flower (tetraploid) 2	32.797
	CNS0095612	Silvery flower (tetraploid) 3	15.452
	CNS0095613	Golden flower (tetraploid) 1	13.708
	CNS0095614	Golden flower (tetraploid) 2	15.673
	CNS0095615	Golden flower (tetraploid) 3	6.822
CRA001975	CRR073297	Stem 1	6.901
	CRR073298	Stem 2	6.990
	CRR073299	Stem 3	7.266
	CRR073300	Leaf 1	6.156
	CRR073301	Leaf 2	8.772
	CRR073302	Leaf 3	8.165
	CRR073303	Juvenile bud 1	7.859
	CRR073304	Juvenile bud 2	7.164
	CRR073305	Juvenile bud 3	5.460
	CRR073306	Third green 1	2.501
	CRR073307	Third green 2	1.657
	CRR073308	Third green 3	1.795
	CRR073309	Second white 1	2.699
	CRR073310	Second white 2	4.974
	CRR073311	Second white 3	3.712
	CRR073312	Silver flowering 1	2.421
	CRR073313	Silver flowering 2	1.670
	CRR073314	Silver flowering 3	1.425
	CRR073315	Gold flowering 1	11.538
	CRR073316	Gold flowering 2	11.415
	CRR073317	Gold flowering 3	3.801
	CRR073318	Tawny withering 1	2.681
	CRR073319	Tawny withering 2	3.249
	CRR073320	Tawny withering 3	2.953