Gene detail

Detail information of GWHGAAZE001419

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002264437.1	1.3851E-119	PREDICTED: probable glutathione S-transferase [Vitis vinifera]
Swissprot	tr\|P49332\|GSTXC_TOBAC	2E-116	Probable glutathione S-transferase parC
trEMBL	tr\|F6HR78\|F6HR78_VITVI	5E-120	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB57186.1}
TAIR10	AT1G78380.1	3E-83	glutathione S-transferase TAU 19

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	37378857	37379869	+
GWHAAZE00000001	mRNA	37378857	37379869	+
GWHAAZE00000001	exon	37378857	37379177	+
GWHAAZE00000001	exon	37379525	37379869	+
GWHAAZE00000001	CDS	37378857	37379177	+
GWHAAZE00000001	CDS	37379525	37379869	+

Transcript Sequence
>GWHTAAZE001423 ATGGGAGGGAGTGAGGTGATTTTGTTGGACTTTTGGGCAAGCATGTTTGGGATGAGGCTGAGGATTGCTCTTGCAGAAAAAGGTATTGAGTATGAGTTCAAAGAAGAGGACTTGGTTAACAACAGAAGCCCATTCCTATCGAAGATGAACCCGGTTCACAAGAAAATCCCGGTTCTCATTCACAATGGGAAACCGGTTTGTGAGTCGCTCATTGCGGTTCAGTACATAGATGAGGTGTGGAAGGGTAAAGCTACATTGTTGCCCTCTGATCCTTACCAGAGAGCTCAGGCTAGGTTTTGGGGTGACTTTATTGACAAGAAGGTATATGATCATGGAGCAAAGATATGGAAAACAAAAGGTGCAGAACAAGAGGAAAGCAAGAAAGGGTTAATAGAGTGCTTAAAATTGCTAGAGGGAGAGCTTGGGGACAAGCCTTTCTTTGGAGGTGAGAGCTTTGGGTTTTTGGACATAGCTTTGGTCCCATTTTACAGCTGGTTTTACACCTATGAGACCTTTGGAAAATTCAGCGTAGAGGCAGAGTGCCCCACATTGATTGGGTGGGTCAAGAGGTGCATGGACAAGGAGAGTGTCTCAAAGTCCCTTGCTGATCCCCACAAGGTCCATGACTTGGTTCTTATCTTGAAAAAGAAGCATGGGCTTGAGTAG

Network for GWHGAAZE001419

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02798.21	GST_N	5	78	1.40E-17
PF13410.7	GST_C_2	123	190	1.80E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00799	GST, gst	Metabolic pathways	map01100
		Glutathione metabolism	map00480
		Metabolism of xenobiotics by cytochrome P450	map00980
		Drug metabolism - cytochrome P450	map00982
		Drug metabolism - other enzymes	map00983
		Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.165
	SRR3591706	second leaf	3.727
	SRR3591707	mature leaf	0.217
	SRR3591708	Shoot apex	1.609
	SRR3591709	Stem	3.573
	SRR3591710	White floral bud	0.187
	SRR3591711	White flower	0.253
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.568
SRP173429	SRR8316895	Juvenile bud stage	0.173
	SRR8316896	Juvenile bud stage	0.748
	SRR8316897	Juvenile bud stage	0.046
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.057
	SRR8316901	Third green stage	0.332
	SRR8316898	Complete white stage	0.046
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.321
	SRR8316904	Silver flowering stage	0.384
	SRR8316905	Silver flowering stage	0.215
	SRR8316906	Gold flowering stage	2.432
	SRR8316907	Gold flowering stage	1.888
	SRR8316908	Gold flowering stage	0.285
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.038
	SRR6706288	Light intensity 20%	0.078
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.023
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.129
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.114
	CNS0095597	Whole white alabastrum(diploid) 4	0.024
	CNS0095598	Silvery flower (diploied) 1	0.043
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.040
	CNS0095601	Golden flower (diploid) 1	0.005
	CNS0095602	Golden flower (diploid) 2	0.237
	CNS0095603	Golden flower (diploid) 3	0.246
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.605
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.136
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.067
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.308
	CRR073300	Leaf 1	0.100
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.045
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.025
	CRR073308	Third green 3	0.017
	CRR073309	Second white 1	0.276
	CRR073310	Second white 2	0.266
	CRR073311	Second white 3	0.080
	CRR073312	Silver flowering 1	0.121
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.014
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.146
	CRR073319	Tawny withering 2	0.230
	CRR073320	Tawny withering 3	0.126