Gene detail

Detail information of GWHGAAZE001464

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ACB20696.1	1.57033E-45	putative cold-inducible protein [Camellia sinensis]
Swissprot	tr\|Q9LX85\|ZAT8_ARATH	7E-30	Zinc finger protein ZAT8
trEMBL	tr\|B2CZY8\|B2CZY8_CAMSI	6E-46	Putative cold-inducible protein {ECO:0000313\|EMBL:ACB20696.1}
TAIR10	AT2G28710.1	1E-25	C2H2-type zinc finger family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	44148432	44148893	+
GWHAAZE00000001	mRNA	44148432	44148893	+
GWHAAZE00000001	exon	44148432	44148893	+
GWHAAZE00000001	CDS	44148432	44148893	+

Transcript Sequence
>GWHTAAZE001468 ATGACAATGAAGAGAAGTAGAGAAGATAATGAAGTAGAAGACATAGCAAGAGCCAATTGCTTGAGGCTCCTCTCTCGCATTGGCCCCACCTCCCGTCTCTTCCGTTGTAAGACATGTAACCGTCAGTTCTCGTCGTTCCAAGCCCTTGGTGGCCACCGGGCCAGTCACAAGAGGCTTATGGTATCACCACCAACACCTGGCGGTGGTGGTGATGGTGGGATTTTGAATAAGGTTAGTTTGCCAACTTATAAGCCAAAGACGCATTTGTGCTCGATATGTGGGGTCGAGTTCGCCATAGGGCAAGCATTAGGTGGTCACATGAGGCGGCACAGACAGAAGGAAGGCCCGGTCACGAAGAAACGGGACGGCAGGACAGATTTCTGGTTTGATTTGAACTTGACTCCTTACGAGAATGATTTGGAGTTTTCGAAGAGACCTCCCATATTAGATTGTTTCATTTGA

Network for GWHGAAZE001464

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13912.7	zf-C2H2_6	34	58	2.10E-11
PF13912.7	zf-C2H2_6	88	112	1.70E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2H2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.236
	SRR3591706	second leaf	0.296
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.584
	SRR3591709	Stem	3.189
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	1.152
	SRR3591712	Green floral bud	0.772
	SRR3591713	Yellow flower	0.567
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.076
	SRR8316897	Juvenile bud stage	0.346
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.224
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.140
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.410
	SRR8316907	Gold flowering stage	0.134
	SRR8316908	Gold flowering stage	1.857
SRP132670	SRR6706286	Control	0.111
	SRR6706287	Light intensity 50%	0.110
	SRR6706288	Light intensity 20%	0.045
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.036
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.522
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.093
	CNS0095597	Whole white alabastrum(diploid) 4	0.056
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.179
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.043
	CNS0095603	Golden flower (diploid) 3	0.061
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.434
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.327
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.438
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.192
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.213
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.081
	CNS0095612	Silvery flower (tetraploid) 3	0.036
	CNS0095613	Golden flower (tetraploid) 1	2.209
	CNS0095614	Golden flower (tetraploid) 2	0.118
	CNS0095615	Golden flower (tetraploid) 3	0.292
CRA001975	CRR073297	Stem 1	0.310
	CRR073298	Stem 2	0.134
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.089
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.303
	CRR073308	Third green 3	0.234
	CRR073309	Second white 1	1.019
	CRR073310	Second white 2	0.488
	CRR073311	Second white 3	0.441
	CRR073312	Silver flowering 1	0.190
	CRR073313	Silver flowering 2	0.549
	CRR073314	Silver flowering 3	0.811
	CRR073315	Gold flowering 1	0.148
	CRR073316	Gold flowering 2	0.613
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.423
	CRR073319	Tawny withering 2	0.432
	CRR073320	Tawny withering 3	1.174