Gene detail

Detail information of GWHGAAZE001628

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003621661.1	4.94318E-46	SKP1-like protein [Medicago truncatula]
Swissprot	tr\|Q9FHW7\|SKP1B_ARATH	2E-43	SKP1-like protein 1B
trEMBL	tr\|G7KSZ5\|G7KSZ5_MEDTR	2E-46	SCF ubiquitin ligase, SKP1 component {ECO:0000313\|EMBL:AES77879.1}
TAIR10	AT5G42190.1	3E-35	E3 ubiquitin ligase SCF complex subunit SKP1/ASK1 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	55024875	55025288	-
GWHAAZE00000001	mRNA	55024875	55025288	-
GWHAAZE00000001	exon	55024875	55025288	-
GWHAAZE00000001	CDS	55024875	55025288	-

Transcript Sequence
>GWHTAAZE001632 ATGGTTTTTGAGGTCAACAAGGCTGTTGTATTCGTATCCGATACAATAAAGCACATTATCGAGGAGAATGGCACCAATAACGCCATTTTGCTACCAGAGGTGAATGGTAAGATTTTATCAAAGGTGATCGAGTACTGCAAGATGCATATCGAGGCTCAGTCCCTCGAGTCCAAAGAACTAAAAAACTTTGACTCCGAGTTCGTGAAAGTGGACCATGACACCCTCTTCGGTATCTTCCTGGCTTCAAATTATCTAAAAATCGAGAGCCTTAGAGATCTGATTGCCCAGACTATAGGGAATATGATGAAGGGGAAAACTCCGGCGGAGATTCGCAAGATTTTCAACATTAGTGATGACTGTAAACCTGAAGGGGAAAACAAGTATGTCGAAGAGAACCAGTGGGCATTCCAGTGA

Network for GWHGAAZE001628

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03931.16	Skp1_POZ	2	49	1.70E-15
PF01466.20	Skp1	89	135	7.30E-16

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	SKP1

KEGG pathway

KO	Enzyme	pathway	mapID
K03094	SKP1, CBF3D	Protein processing in endoplasmic reticulum	map04141
		Ubiquitin mediated proteolysis	map04120
		Wnt signaling pathway	map04310
		Hedgehog signaling pathway - fly	map04341
		TGF-beta signaling pathway	map04350
		Cell cycle	map04110
		Cell cycle - yeast	map04111
		Oocyte meiosis	map04114
		Circadian rhythm	map04710

Gene Ontology

GO term	Ontology	Name
GO:0006511	biological_process	ubiquitin-dependent protein catabolic process

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.259
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.350
	SRR3591708	Shoot apex	0.226
	SRR3591709	Stem	0.060
	SRR3591710	White floral bud	2.113
	SRR3591711	White flower	4.522
	SRR3591712	Green floral bud	1.138
	SRR3591713	Yellow flower	8.270
SRP173429	SRR8316895	Juvenile bud stage	3.169
	SRR8316896	Juvenile bud stage	3.889
	SRR8316897	Juvenile bud stage	2.446
	SRR8316894	Third green stage	2.143
	SRR8316900	Third green stage	1.075
	SRR8316901	Third green stage	1.312
	SRR8316898	Complete white stage	0.911
	SRR8316899	Complete white stage	0.948
	SRR8316903	Complete white stage	1.270
	SRR8316902	Silver flowering stage	1.454
	SRR8316904	Silver flowering stage	3.883
	SRR8316905	Silver flowering stage	0.615
	SRR8316906	Gold flowering stage	7.386
	SRR8316907	Gold flowering stage	8.136
	SRR8316908	Gold flowering stage	14.804
SRP132670	SRR6706286	Control	1.800
	SRR6706287	Light intensity 50%	0.768
	SRR6706288	Light intensity 20%	1.160
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.700
	CNS0095593	Slightly white alabastrum(diploid) 2	3.015
	CNS0095594	Slightly white alabastrum(diploid) 3	3.030
	CNS0095595	Whole white alabastrum(diploid) 2	1.199
	CNS0095596	Whole white alabastrum(diploid) 3	1.337
	CNS0095597	Whole white alabastrum(diploid) 4	0.766
	CNS0095598	Silvery flower (diploied) 1	7.511
	CNS0095599	Silvery flower (diploied) 2	5.431
	CNS0095600	Silvery flower (diploied) 3	4.579
	CNS0095601	Golden flower (diploid) 1	9.057
	CNS0095602	Golden flower (diploid) 2	7.730
	CNS0095603	Golden flower (diploid) 3	8.425
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.592
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.392
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.121
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.314
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.341
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.237
	CNS0095610	Silvery flower (tetraploid) 1	4.389
	CNS0095611	Silvery flower (tetraploid) 2	6.832
	CNS0095612	Silvery flower (tetraploid) 3	3.458
	CNS0095613	Golden flower (tetraploid) 1	4.158
	CNS0095614	Golden flower (tetraploid) 2	4.877
	CNS0095615	Golden flower (tetraploid) 3	4.747
CRA001975	CRR073297	Stem 1	2.120
	CRR073298	Stem 2	2.217
	CRR073299	Stem 3	2.581
	CRR073300	Leaf 1	0.227
	CRR073301	Leaf 2	0.755
	CRR073302	Leaf 3	0.217
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.084
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.510
	CRR073307	Third green 2	0.445
	CRR073308	Third green 3	1.414
	CRR073309	Second white 1	1.706
	CRR073310	Second white 2	2.447
	CRR073311	Second white 3	1.210
	CRR073312	Silver flowering 1	2.135
	CRR073313	Silver flowering 2	0.529
	CRR073314	Silver flowering 3	0.088
	CRR073315	Gold flowering 1	2.936
	CRR073316	Gold flowering 2	2.405
	CRR073317	Gold flowering 3	2.117
	CRR073318	Tawny withering 1	4.522
	CRR073319	Tawny withering 2	5.826
	CRR073320	Tawny withering 3	1.986