Gene detail

Detail information of GWHGAAZE001648

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002299088.2	7.24889E-54	PUR alpha-1 family protein [Populus trichocarpa]
Swissprot	tr\|Q9SKZ1\|PUR_ARATH	7E-49	Transcription factor Pur-alpha 1
trEMBL	tr\|F6GUS0\|F6GUS0_VITVI	2E-58	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43827.1}
TAIR10	AT2G32080.2	6E-41	purin-rich alpha 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	56444031	56445396	-
GWHAAZE00000001	mRNA	56444031	56445396	-
GWHAAZE00000001	exon	56444031	56444193	-
GWHAAZE00000001	exon	56445074	56445396	-
GWHAAZE00000001	CDS	56445074	56445396	-
GWHAAZE00000001	CDS	56444031	56444193	-

Transcript Sequence
>GWHTAAZE001652 ATGGAAGGGAATTCAGGGGGAGGGGGAGGAGGAGGTGGTGGTGATGTGGAGTTGGTGTCGAAGACATTGCAGGTGGAGCACAAGCTGTTCTACTTCGATCTCAAGGAGAATCCGCGTGGCCGATACCTTAAGATCTCTGAGAAAACCTCGGCCACTAGGTCCACTATCATCGTGCCCTTCAATGGCATCCCTTGGTTCTTGGATCTCTTTAATTACTACGTCAATTCGGCCGATGATGATCAGGATGTATTTAGCAAGGAATTACAGCTCGACACCAAGGCAATTTCATTCGCTTTGCCTTTCCTTCTTCTTTATTATCTATTTCCCTTACTTGTCTCAACCAACTGTTTCATTCAGGTGTTCTACTTCGACATTGGCGAGAATAGAAGGGGTCGCTTCTTGAAGGTTCTCTTTTCCACTTTGCCCCTCCTATACTCTATTACTATTATTCTTTTCTCTACCTTGGCTCAAATGATATTGTTATGA

Network for GWHGAAZE001648

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0173

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04845.14	PurA	18	75	8.80E-10
PF07986.13	TBCC	315	427	1.10E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0000902	biological_process	cell morphogenesis
GO:0000977	molecular_function	RNA polymerase II transcription regulatory region sequence-specific DNA binding
GO:0032422	molecular_function	purine-rich negative regulatory element binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	40.717
	SRR3591706	second leaf	26.682
	SRR3591707	mature leaf	18.004
	SRR3591708	Shoot apex	31.219
	SRR3591709	Stem	41.510
	SRR3591710	White floral bud	37.996
	SRR3591711	White flower	41.799
	SRR3591712	Green floral bud	45.775
	SRR3591713	Yellow flower	41.509
SRP173429	SRR8316895	Juvenile bud stage	42.091
	SRR8316896	Juvenile bud stage	65.677
	SRR8316897	Juvenile bud stage	24.895
	SRR8316894	Third green stage	23.354
	SRR8316900	Third green stage	65.360
	SRR8316901	Third green stage	65.232
	SRR8316898	Complete white stage	21.376
	SRR8316899	Complete white stage	76.012
	SRR8316903	Complete white stage	34.738
	SRR8316902	Silver flowering stage	20.399
	SRR8316904	Silver flowering stage	28.012
	SRR8316905	Silver flowering stage	15.719
	SRR8316906	Gold flowering stage	65.058
	SRR8316907	Gold flowering stage	69.451
	SRR8316908	Gold flowering stage	77.911
SRP132670	SRR6706286	Control	85.334
	SRR6706287	Light intensity 50%	88.526
	SRR6706288	Light intensity 20%	89.147
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	43.245
	CNS0095593	Slightly white alabastrum(diploid) 2	40.501
	CNS0095594	Slightly white alabastrum(diploid) 3	41.590
	CNS0095595	Whole white alabastrum(diploid) 2	30.131
	CNS0095596	Whole white alabastrum(diploid) 3	36.453
	CNS0095597	Whole white alabastrum(diploid) 4	24.487
	CNS0095598	Silvery flower (diploied) 1	36.317
	CNS0095599	Silvery flower (diploied) 2	27.954
	CNS0095600	Silvery flower (diploied) 3	34.811
	CNS0095601	Golden flower (diploid) 1	26.646
	CNS0095602	Golden flower (diploid) 2	36.087
	CNS0095603	Golden flower (diploid) 3	37.911
	CNS0095604	Slightly white alabastrum(tetraploid) 1	60.884
	CNS0095605	Slightly white alabastrum(tetraploid) 2	56.991
	CNS0095606	Slightly white alabastrum(tetraploid) 3	82.479
	CNS0095607	Whole white alabastrum(tetraploid) 1	35.989
	CNS0095608	Whole white alabastrum(tetraploid) 2	31.043
	CNS0095609	Whole white alabastrum(tetraploid) 3	64.668
	CNS0095610	Silvery flower (tetraploid) 1	49.469
	CNS0095611	Silvery flower (tetraploid) 2	37.570
	CNS0095612	Silvery flower (tetraploid) 3	31.635
	CNS0095613	Golden flower (tetraploid) 1	37.766
	CNS0095614	Golden flower (tetraploid) 2	51.640
	CNS0095615	Golden flower (tetraploid) 3	29.662
CRA001975	CRR073297	Stem 1	82.741
	CRR073298	Stem 2	69.756
	CRR073299	Stem 3	66.712
	CRR073300	Leaf 1	84.579
	CRR073301	Leaf 2	76.535
	CRR073302	Leaf 3	78.227
	CRR073303	Juvenile bud 1	66.862
	CRR073304	Juvenile bud 2	66.705
	CRR073305	Juvenile bud 3	74.020
	CRR073306	Third green 1	35.223
	CRR073307	Third green 2	37.339
	CRR073308	Third green 3	37.550
	CRR073309	Second white 1	22.680
	CRR073310	Second white 2	28.948
	CRR073311	Second white 3	26.200
	CRR073312	Silver flowering 1	24.423
	CRR073313	Silver flowering 2	16.391
	CRR073314	Silver flowering 3	23.185
	CRR073315	Gold flowering 1	27.068
	CRR073316	Gold flowering 2	29.172
	CRR073317	Gold flowering 3	18.398
	CRR073318	Tawny withering 1	44.956
	CRR073319	Tawny withering 2	31.383
	CRR073320	Tawny withering 3	38.784