Gene detail

Detail information of GWHGAAZE001715

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011100440.1	3.1064E-133	PREDICTED: pentatricopeptide repeat-containing protein At3g59040 [Sesamum indicum]
Swissprot	tr\|Q9LYT2\|PP287_ARATH	2E-107	Pentatricopeptide repeat-containing protein At3g59040
trEMBL	tr\|K4CEL7\|K4CEL7_SOLLC	2E-125	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc07g043600.2.1}
TAIR10	AT3G59040.1	1E-89	Tetratricopeptide repeat (TPR)-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	58502332	58510750	-
GWHAAZE00000001	mRNA	58502332	58510750	-
GWHAAZE00000001	exon	58510683	58510750	-
GWHAAZE00000001	exon	58508982	58509294	-
GWHAAZE00000001	exon	58504172	58504462	-
GWHAAZE00000001	exon	58502332	58502397	-
GWHAAZE00000001	CDS	58510683	58510750	-
GWHAAZE00000001	CDS	58508982	58509294	-
GWHAAZE00000001	CDS	58504172	58504462	-
GWHAAZE00000001	CDS	58502332	58502397	-

Transcript Sequence
>GWHTAAZE001719 ATGCCTCAAAGTATGTTGTTAAACGTCAAACCATTTATTTCTTCTGCTCCTCCCACTCTCAATTGGAGGAAGCAGATTAATACAGGCATTCATGTTGATGGGAATGTCAAAATCCGAAGAAGAGCAGAGGTAGTCTGTTTTGGTATGTTGGCGCCAAGAAAGTTCATGCGAAAGAGAAAAACGGTAGAAGTTTTCAAGGATGCTGCTGATGAAGCAGATCAGAAGAACTGGAGGAAGTTGATGAACGAAATTGAAGAGGGTGGCTCTGCTGTTTCCGTGCTCAGAACTCAAAAACTCAAGAACAACTTTCTTCCTAAGGACCTTGTTCTTGGCACTCTAGTTAGATTCAAACAGCTAAAGAAGTGGAATCTTGTTAGTGAGATACTTGAATGGCTTCGCACTCAACATTGGTGGGATTTTAATGAAATGGATACTCTGATGCTTATTACTGCTTACGGAAAGCAAGGGGACTTTAACAAGGCCGAAAGAGTTTTCAGCTACATCAACAAGAAAGGATACCCCCCAAATGTGATATCCCACACTGCTCTTATGGAAGCATATGGAAAGGGAGGTCAGTACAATAGAGCGGAAGCAATATTTCGAAGAATGCAATCTTCAGGACCTGAACCTTCTGCTGTAACATATCAAATAATTCTCAAATCATTTGTGGAGGGAGATAAGTTTAAGGAAGCAGAAGCCATCTTTGAAACCCTTCTAGACAATGAGGTCTCCCTTTGA

Network for GWHGAAZE001715

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01535.21	PPR	148	172	0.0066
PF13041.7	PPR_2	175	222	1.40E-09
PF00249.32	Myb_DNA-binding	35	80	7.80E-14
PF00249.32	Myb_DNA-binding	87	130	2.50E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	MYB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	18.304
	SRR3591706	second leaf	22.488
	SRR3591707	mature leaf	26.447
	SRR3591708	Shoot apex	20.784
	SRR3591709	Stem	10.513
	SRR3591710	White floral bud	18.268
	SRR3591711	White flower	26.685
	SRR3591712	Green floral bud	11.297
	SRR3591713	Yellow flower	25.046
SRP173429	SRR8316895	Juvenile bud stage	8.549
	SRR8316896	Juvenile bud stage	8.151
	SRR8316897	Juvenile bud stage	7.490
	SRR8316894	Third green stage	6.424
	SRR8316900	Third green stage	15.133
	SRR8316901	Third green stage	11.356
	SRR8316898	Complete white stage	10.059
	SRR8316899	Complete white stage	14.067
	SRR8316903	Complete white stage	17.873
	SRR8316902	Silver flowering stage	9.226
	SRR8316904	Silver flowering stage	20.028
	SRR8316905	Silver flowering stage	8.462
	SRR8316906	Gold flowering stage	29.366
	SRR8316907	Gold flowering stage	27.476
	SRR8316908	Gold flowering stage	20.491
SRP132670	SRR6706286	Control	2.918
	SRR6706287	Light intensity 50%	4.012
	SRR6706288	Light intensity 20%	3.836
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.290
	CNS0095593	Slightly white alabastrum(diploid) 2	3.065
	CNS0095594	Slightly white alabastrum(diploid) 3	2.361
	CNS0095595	Whole white alabastrum(diploid) 2	2.528
	CNS0095596	Whole white alabastrum(diploid) 3	2.293
	CNS0095597	Whole white alabastrum(diploid) 4	4.371
	CNS0095598	Silvery flower (diploied) 1	16.653
	CNS0095599	Silvery flower (diploied) 2	13.653
	CNS0095600	Silvery flower (diploied) 3	25.623
	CNS0095601	Golden flower (diploid) 1	8.126
	CNS0095602	Golden flower (diploid) 2	24.308
	CNS0095603	Golden flower (diploid) 3	21.295
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.851
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.797
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.091
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.839
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.932
	CNS0095609	Whole white alabastrum(tetraploid) 3	14.596
	CNS0095610	Silvery flower (tetraploid) 1	24.793
	CNS0095611	Silvery flower (tetraploid) 2	30.256
	CNS0095612	Silvery flower (tetraploid) 3	23.234
	CNS0095613	Golden flower (tetraploid) 1	7.303
	CNS0095614	Golden flower (tetraploid) 2	21.116
	CNS0095615	Golden flower (tetraploid) 3	23.705
CRA001975	CRR073297	Stem 1	11.827
	CRR073298	Stem 2	6.974
	CRR073299	Stem 3	8.332
	CRR073300	Leaf 1	5.913
	CRR073301	Leaf 2	4.957
	CRR073302	Leaf 3	7.840
	CRR073303	Juvenile bud 1	3.613
	CRR073304	Juvenile bud 2	2.647
	CRR073305	Juvenile bud 3	3.491
	CRR073306	Third green 1	1.539
	CRR073307	Third green 2	1.701
	CRR073308	Third green 3	1.986
	CRR073309	Second white 1	2.332
	CRR073310	Second white 2	6.366
	CRR073311	Second white 3	3.420
	CRR073312	Silver flowering 1	2.404
	CRR073313	Silver flowering 2	2.669
	CRR073314	Silver flowering 3	2.626
	CRR073315	Gold flowering 1	12.548
	CRR073316	Gold flowering 2	25.087
	CRR073317	Gold flowering 3	10.335
	CRR073318	Tawny withering 1	4.075
	CRR073319	Tawny withering 2	4.742
	CRR073320	Tawny withering 3	4.995