Gene detail

Detail information of GWHGAAZE001717

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011082942.1	1.83077E-81	PREDICTED: HVA22-like protein f [Sesamum indicum]
Swissprot	tr\|Q682H0\|HA22F_ARATH	6E-66	HVA22-like protein f
trEMBL	tr\|A0A022Q9N4\|A0A022Q9N4_ERYGU	5E-80	Uncharacterized protein {ECO:0000313\|EMBL:EYU23240.1}
TAIR10	AT2G42820.1	2E-52	HVA22-like protein F

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	58529959	58531019	-
GWHAAZE00000001	mRNA	58529959	58531019	-
GWHAAZE00000001	exon	58530973	58531019	-
GWHAAZE00000001	exon	58530628	58530750	-
GWHAAZE00000001	exon	58529959	58530220	-
GWHAAZE00000001	CDS	58530973	58531019	-
GWHAAZE00000001	CDS	58530628	58530750	-
GWHAAZE00000001	CDS	58529959	58530220	-

Transcript Sequence
>GWHTAAZE001721 ATGTTTTGGCTGTATACCAGGCCAGGAGTGATGCTTCTTTTTCCTCTGTACGCATCAATGAGAGCTATAGAGAGTCCTTCAACGCTAGATGATCAACAGTGGCTAACTTACTGGGTCCTCTACTCCTTCATTTCCCTCTTTGAGCTCTCCTGCTGGAAAATCCTTCAATGGCTTCCATTCTGGCCATACATCAAGCTGGTGTTTTGTATGTGGTTGGTGCTGCCAATATTCAATGGGGCTGCTTACATTTACGAGAATTTAGTGCGCAAGTATGTCAAAGTTGGTAGCTATGTCAGCCCAAACTACACCAATGGCCAGAAAAAAGTTCTGCAAATGATGTCCCTCGATGCTCGCAAGTCCGTCGAACATTACATCCAAACCTATGGTCCAGATGCTTTCGAAAGAGTAGTCAAAGCCGTAAGATCATCATAA

Network for GWHGAAZE001717

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03134.20	TB2_DP1_HVA22	15	91	2.10E-26
PF00071.23	Ras	5	165	1.50E-64

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07874	RAB1A	Autophagy - animal	map04140

Gene Ontology

GO term	Ontology	Name
GO:0003924	molecular_function	GTPase activity
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	38.325
	SRR3591706	second leaf	19.942
	SRR3591707	mature leaf	3.710
	SRR3591708	Shoot apex	20.406
	SRR3591709	Stem	39.461
	SRR3591710	White floral bud	177.892
	SRR3591711	White flower	230.291
	SRR3591712	Green floral bud	59.530
	SRR3591713	Yellow flower	99.923
SRP173429	SRR8316895	Juvenile bud stage	6.856
	SRR8316896	Juvenile bud stage	7.577
	SRR8316897	Juvenile bud stage	4.801
	SRR8316894	Third green stage	5.113
	SRR8316900	Third green stage	17.055
	SRR8316901	Third green stage	20.267
	SRR8316898	Complete white stage	18.744
	SRR8316899	Complete white stage	20.300
	SRR8316903	Complete white stage	33.172
	SRR8316902	Silver flowering stage	65.486
	SRR8316904	Silver flowering stage	80.335
	SRR8316905	Silver flowering stage	8.470
	SRR8316906	Gold flowering stage	15.776
	SRR8316907	Gold flowering stage	30.919
	SRR8316908	Gold flowering stage	12.783
SRP132670	SRR6706286	Control	14.101
	SRR6706287	Light intensity 50%	14.101
	SRR6706288	Light intensity 20%	11.992
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	31.766
	CNS0095593	Slightly white alabastrum(diploid) 2	34.175
	CNS0095594	Slightly white alabastrum(diploid) 3	21.365
	CNS0095595	Whole white alabastrum(diploid) 2	22.125
	CNS0095596	Whole white alabastrum(diploid) 3	37.373
	CNS0095597	Whole white alabastrum(diploid) 4	20.709
	CNS0095598	Silvery flower (diploied) 1	19.248
	CNS0095599	Silvery flower (diploied) 2	20.278
	CNS0095600	Silvery flower (diploied) 3	45.151
	CNS0095601	Golden flower (diploid) 1	11.010
	CNS0095602	Golden flower (diploid) 2	15.161
	CNS0095603	Golden flower (diploid) 3	14.355
	CNS0095604	Slightly white alabastrum(tetraploid) 1	24.250
	CNS0095605	Slightly white alabastrum(tetraploid) 2	27.769
	CNS0095606	Slightly white alabastrum(tetraploid) 3	26.136
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.521
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.404
	CNS0095609	Whole white alabastrum(tetraploid) 3	12.299
	CNS0095610	Silvery flower (tetraploid) 1	40.041
	CNS0095611	Silvery flower (tetraploid) 2	21.870
	CNS0095612	Silvery flower (tetraploid) 3	22.163
	CNS0095613	Golden flower (tetraploid) 1	2.261
	CNS0095614	Golden flower (tetraploid) 2	54.439
	CNS0095615	Golden flower (tetraploid) 3	33.903
CRA001975	CRR073297	Stem 1	8.994
	CRR073298	Stem 2	9.573
	CRR073299	Stem 3	10.357
	CRR073300	Leaf 1	18.683
	CRR073301	Leaf 2	20.596
	CRR073302	Leaf 3	21.282
	CRR073303	Juvenile bud 1	24.255
	CRR073304	Juvenile bud 2	21.643
	CRR073305	Juvenile bud 3	27.758
	CRR073306	Third green 1	40.646
	CRR073307	Third green 2	79.274
	CRR073308	Third green 3	83.437
	CRR073309	Second white 1	8.445
	CRR073310	Second white 2	7.422
	CRR073311	Second white 3	4.359
	CRR073312	Silver flowering 1	4.153
	CRR073313	Silver flowering 2	4.641
	CRR073314	Silver flowering 3	2.439
	CRR073315	Gold flowering 1	6.375
	CRR073316	Gold flowering 2	4.806
	CRR073317	Gold flowering 3	3.234
	CRR073318	Tawny withering 1	23.136
	CRR073319	Tawny withering 2	25.373
	CRR073320	Tawny withering 3	25.870